10.05.2018
218.016.3e72

Способ ДНК-диагностики врожденной формы катаракты (CTRCT18)

Вид РИД

Изобретение

Юридическая информация Свернуть Развернуть
Краткое описание РИД Свернуть Развернуть
Аннотация: Изобретение относится к области медицины, в частности к медицинской генетике и офтальмологии, и предназначено для ДНК-диагностики врожденной формы катаракты. Из периферической крови выделяют ДНК. Проводят амплификацию фрагментов ДНК с помощью специфических пар олигонуклеотидных праймеров и обработку полученных амплификатов эндонуклеазой рестрикции PstI с последующей детекцией мутации с.1621C>T (p.Gln541Ter) гена FYCO1 электрофорезом в агарозном геле. Изобретение обеспечивает высокую точность диагностики врожденной формы катаракты (CTRCT18). 3 ил., 1 табл., 5 пр.
Реферат Свернуть Развернуть

Способ ДНК-диагностики врожденной формы катаракты (CTRCT18) относится к медицине, а именно к медицинской генетике и офтальмологии.

Врожденная катаракта признана основной причиной детской слепоты во многих популяциях мира, поскольку вызывает физическое помутнение хрусталика глаза, что впоследствии может привести к различным расстройствам зрения вплоть до полной его утраты.

Врожденная катаракта встречается с частотой 1-6 на 10000 новорожденных (см. Robinson GC, Jan JE, Kinnis C. Congenital ocular blindness in children 1945 to 1984. Am J Dis Child. 1987. 141: 1321-1324). При этом от 8,3 до 25,0 % случаев врожденной катаракты являются наследственными (см. Merin S. Inherited Cataracts. Inherited Eye Diseases. 1991. S.Merin (Ed.) Marcel Dekker, Inc., New York: 86–120).

Большинство зарегистрированных в мире наследственных несиндромальных форм врожденной катаракты являются генетически гетерогенными и наследуются как по аутосомно-доминантному и аутосомно-рецессивному, так и по Х-сцепленному рецессивному типу. В настоящее время для человека идентифицировано более 40 локусов врожденной катаракты и примерно для половины из них известны мутации в конкретных генах (см. Shiels A, Bennett TM, Hejtmancik JF. Cat-Map: Putting cataract on the map. Mol. Vis., 2010. 16: 2007-2015).

Впервые наследственная аутосомно-рецессивная врожденная форма катаракты (CTRCT18, ОMIM 610019) была картирована на хромосоме 3 в 2001 году при изучении трех инбредных арабских семей с врожденной катарактой, но генов, ассоциированных с этой формой заболевания, не было идентифицировано (см. Pras E, Pras E, Bakhan T et al. A gene causing autosomal recessive cataract maps to the short arm of chromosome 3. Isr. Med. Assoc. 2001. J.3: 559-562). Позднее, в 2011 году при изучении 12 пакистанских и одной арабо-израильской семьи с аутосомно-рецессивной врожденной катарактой (большинство семей были инбредными) был идентифицирован ген FYCO1, расположенный в критическом регионе сцепления локуса CATC2 (см. Chen J, Ma Z, Jiao X. Mutations in FYCO1 cause autosomal-recessive congenital cataracts. Am J Hum Genet. 2011. 88: 827-38). В кодирующей области этого гена было обнаружено 9 различных изменений нуклеотидной последовательности, затрагивающих функционально значимые домены белка: COILED COIL, LIR и GOLD (см. Chen J, Ma Z, Jiao X. Mutations in FYCO1 cause autosomal-recessive congenital cataracts. Am J Hum Genet. 2011. 88: 827-38).

Известен способ прогнозирования развития катаракты путем обнаружения противохрусталиковых антител в сыворотке крови и слезе, при котором у детей после экстракции врожденной катаракты перед операцией в сыворотке крови и в слезе определяют тканеспецифические антитела к Bl- фракции ткани хрусталика и при наличии их в титре, большем или равном 1:32 в сыворотке и большем или равном 1:256 в слезе, прогнозируют развитие катаракты (см. RU №2021610, МПК G01N 33/53, опубл. 15.10.1994).

Известное решение является «косвенным» свидетельством развития катаракты и его точность может зависеть от множества как экзогенных, так и эндогенных факторов.

Известен способ ДНК-тестирования аутосомно-доминантной зонулярной порошкообразной врожденной катаракты, обусловленной мутацией c.741T>G (p.Ile247Met) в гене GJA8 (коннексин 50) (см. Polyakov AV, Shagina IA, Khlebnikova OV, Evgrafov OV. Mutation in the connexin 50 gene (GJA8) in a Russian family with zonular pulverulent cataract. Clan Genet. 2001 Dec;60(6):476-8), где образцы тестируемых ДНК выделяются из периферической крови, слюны или буккального эпителия, затем выделенные образцы ДНК амплифицируются в термоциклире с помощью специфических пар олигонуклеотидных праймеров, фланкирующих область мутации с.741T>G в гене GJA50 в присутствии стандартных ионных буферов и термофильного фермента Taq-полимеразы. После проведения всех необходимых раундов ПЦР амплификаты подвергаются ферментативному гидролизу ферментом HinfI, который специфически узнает полиндромный участок, содержащий или не содержащий мутацию c.741T>G (p.Ile247Met).

Известный способ несет частный характер и относится к решению ДНК-диагностики одной из форм врожденной катаракты, обнаруженной в одной семье, и по нему нельзя однозначно оценить возможность тестирования других форм врожденной катаракты, обусловленных иными мутациями в других генах.

Задачей, на решение которой направлено заявляемое изобретение, является создание способа ДНК-диагностики аутосомно-рецессивной катаракты (CTRCT18), распространенной в Якутии.

Технический результат, получаемый при решении поставленной задачи, выражается в диагностике врожденной формы катаракты (CTRCT18) с высокой точностью.

Для решения поставленной задачи способ ДНК-диагностики врожденной формы катаракты (CTRCT18) включает стадии выделения образцов ДНК, тестируемых из периферической крови, амплификации фрагментов ДНК с помощью специфических пар олигонуклеотидных праймеров (F)5'TTGGCCTGCCGGAGCTCTT3', (R)5'AGTGACCTGGAGGAGCAGAAGAAGCAGCGCATT3' и обработки полученных амплификатов эндонуклеазой рестрикции PstI с последующей детекцией мутации с.1621C>T (p.Gln541Ter) гена FYCO1 в ультрафиолетовом свете после электрофоретического разделения продуктов гидролиза в 4 % агарозном геле.

Сопоставительный анализ признаков заявленного решения с признаками аналогов свидетельствует о соответствии заявленного решения критерию «новизна».

Совокупность признаков изобретения обеспечивает решение заявленной технической задачи, а именно, получение достоверных результатов молекулярно-генетической диагностики врожденной формы аутосомно-рецессивной катаракты (CTRCT18), распространенной в Якутии.

Врожденная катаракта – основная причина детской слепоты во многих популяциях мира (см. Robinson GA, Nylander A. Warfarin and cataract extraction. // Br J Ophthalmol. 1989 Sep;73(9):702-3). Но именно в Якутии врожденная аутосомно-рецессивная катаракта является одним из наиболее частых органных заболеваний (частота 1 на 8257 человек) (см. Тарская Л.А., Зинченко Р.А., Ельчинова Г.И. и др., Структура и разнообразие наследственной патологии в Республике Саха (Якутия). Генетика. 2004;40(11):1530-1539). При этом генетические причины данной формы потери зрения ранее не были установлены.

Заявленное решение иллюстрируется чертежом, где

- на фигуре 1 показана схема идентификации мутации c.1621C>T (p.Gln541Ter) в гене FYCO1 в якутской семье с врожденной катарактой: а – фото глаз членов семьи со случаями врожденной катаракты: K1 - здоровый контроль, M - Мать пробанда (II:2), PI - пробанд 1 (I:3); б – идентификация нонсенс-мутации с.1621C>T (p.Gln541Ter) с помощью прямого секвенирования по Сэнгеру фрагмента 8-го экзона гена FYCO1: вверху - норма, посередине - гетерозигота, внизу - гомозигота по мутации с.1621C>T; в – результаты ПЦР-ПДРФ анализа (4% агарозный гель) и фрагмент родословной обследованной семьи: Mr—маркер молекулярного веса PUC19/MspI, KI – c.[wt];[wt] (контроль 1), F– c.[1621C>T];[wt] (отец пробанда II:1), P1, P2 и P3 - c.[1621C>T];[1621C>T] - пробанд 1 (I:3), пробанд 2 (I:4) и пробанд 3 (I:5), M - Мать пробанда (II:2) c.[1621C>T];[wt], K2 - c.[wt];[wt] (контроль 2);

- на фигуре 2 показана область перекрывания оригинальной последовательности олигонуклеотидных праймеров для детекции мутации с.1621C>T в гене FYCO1 (комплиментарная последовательность NM_024513.3), при этом стрелка 1 соответствует прямому олигонуклеотидному праймеру №1 (последовательность выделена жирным и подчеркнута снизу), стрелка 2 соответствует обратному мисс-матч праймеру №2 (последовательность выделена жирным и подчеркнута снизу), a/g – область мутации, (A/C) - искусственно созданная замена А-аденина (нативная последовательность) на С-цитозин (измененная последовательность). При наличии искусственной замены в мисс-матч праймере (замена A на C) появляется сайт рестрикции для PctI: GAATGCN↑ (серая заливка);

- на фигуре 3 показана электрофореграмма ПЦР-ПДРФ анализа для детекции мутации с.1621C>T в гене FYCO1, приводящей к врожденной аутосомно-рецессивной форме катаракты (CTRCT18) (4% агарозный гель), при этом дорожка 1, 9 – маркер молекулярного веса Puc19/MspI, дорожки 2, 8 – индивиды без мутации, дорожки 3 и 7 гетерозиготы по мутации с.1621C>T, дорожки 4, 5 и 6 – гомозиготы по мутации с.1621C>T (примечание: при наличии мутации в гомозиготном состоянии сайт рестрикции отсутствует, размер фрагмента 270 п.н.; при наличии мутации в гетерозиготном состоянии будет наличие двух визуализируемых бэндов: 270 п.н. и 243 п.н.; при отсутствии мутации будет наличие одного визуализируемого бэнда размером в 243 п.н.).

При помощи полноэкзомного секвенирования (Illumina NextSeq 500) соавторами была обнаружена основная молекулярно-генетическая причина аутосомно-рецессивной формы катаракты, распространенной в Якутии, обусловленной ранее неизвестной нонсенс-мутацией с.1621C>T (p.Gln541Ter) в гене FYCO1 (см. Барашков Н.А., Коновалов Ф.А., Соловьев А.В., Терютин Ф.М., Пшенникова В.Г., Сапожникова Н.В., Вытюжина Л.С., Томский М.И., Джемилева Л.У., Хуснутдинова Э.К., Посух О.Л., Федорова С.А. Новая транзиция c.1621C>T(p.Gln541*) гена FYCO1 – основная причина аутосомно-рецессивной формы катракты (CTRCT18) в Якутии: результаты полноэкзомного секвенирования // Медицинская генетика. 2016. - Т.15. - №10. - (172). – С. 25-34).

Таким образом, для поиска молекулярно-генетических причин врожденной аутосомно-рецессивной формы катаракты было проведено полноэкзомное секвенирование в одной якутской семье с тремя пораженными разнополыми сибсами, у которых родители имели сохранное зрение. В данном случае, полноэкзомный анализ выявил гомозиготную транзицию c.1621C>T (chr3:46009205G>A) в 8-м экзоне гена FYCO1 (FYVE and coiled-coil domain containing 1) (3p21.31). При этом у всех трех пораженных сибсов мутация обнаружена в гомозиготном, а у здоровых родителей – в гетерозиготном состоянии (см. фиг. 1).

Мутации в гене FYCO1 ранее были известны в ассоциации с аутосомно-рецессивной формой катаракты (CTRCT18, OMIM:610019), встречающейся в популяциях Пакистана (см. Chen J, Ma Z, Jiao X, Fariss R. et al. Mutations in FYCO1 cause autosomal-recessive congenital cataracts. // Am J Hum Genet. 2011 Jun 10;88(6):827-38. doi: 10.1016/j.ajhg.2011.05.008).

Выявленная в исследовании нуклеотидная замена c.1621C>T приводит к образованию преждевременного стоп-кодона p.Gln541Ter (NM_024513.3), терминирующего трансляцию белка FYCO1, участвующего в развитии хрусталика глаза человека. В настоящее время сведения о данной мутации отсутствуют в базах данных 1000 Genomes, ESP6500 и ExAC. Прямое секвенирование по Сэнгеру фрагмента 8-го экзона гена FYCO1 подтвердило полученные результаты.

Заявленный способ детекции данной мутации с помощью молекулярно-генетического метода осуществляется следующим образом.

С информированного согласия пациента производится забор крови из локтевой вены в вакуумные пробирки (вакутейнеры), содержащие антикоагулянт (ЭДТА).

Далее из лимфоцитов крови выделяется ДНК методом фенольно-хлороформной экстракции (см. Mathew C.C.The isolation of high molecular weight eucariotic DNA. // Methods in Molecular Biology /Ed. Walker J.M.Y.L.: Human Press. 1984. -V.2. - P.31-34), для этого:

• кровь в пробирке тщательно перемешивают и переливают в центрифужный стакан объемом 50,0 мл, далее добавляют 30,0 мл охлажденного лизирующего буфера, содержащего 320,0 мМ сахарозы, 1,0% раствора тритона Х-100, 5,0 мМ MgCl2 и 10,0 мМтрис HCl (рН 7,6);

• смесь центрифугируют в течение 20 мин при частоте оборота 4000 об/мин;

• надосадочную жидкость сливают, а к получившемуся осадку добавляют 0,4 мл 10,0% SDS и протеиназу К (концентрации 10,0 мг/мл), после чего смесь для лизиса оставляют на 16 часов в термостате при температуре 37°С;

• к лизату добавляют 0,5 мл фенола, насыщенного 1М трис HCl до рН 7,8;

• смесь встряхивают на шейкере и центрифугируют в течение 10 мин при частоте оборота 6000 об/мин;

• отбирают водную фазу, содержащую ДНК и неденатурированные белки;

• отобранную фазу обрабатывают смесью фенол-хлороформа (1:1), а затем хлороформом;

• препараты осаждают двумя объемами охлажденного этанола 96,0%;

• образовавшийся осадок ДНК растворяют в 1,5 мл деионизированной Н2О;

• раствор хранят при температуре -20°С.

В дальнейшем полученную ДНК используют в качестве матрицы при полимеразной цепной реакции (ПЦР) для амплификации нужного фрагмента гена FYCO1. Способ осуществляется с применением стандартного состава реакционной смеси: 0,8 мкг геномной ДНК, соответствующее количество каждого олигонуклеотида, 125,0 мкМ каждого дезоксинуклеозидтрифосфата помещают в 12,5 мкл однократного буфера для ПЦР следующего состава: 67,0 mMTris-HCl (pH 8,8); 6,7 mM MgCl2; 16,6 mM (NH4)2SO4. К полученной смеси прибавляют 5 единиц термофильной ДНК-полимеразы. При этом применяют следующий режим амплификации: 1) предварительная денатурация в течение 5 минут при температуре 95°С, далее 28 циклов со следующими параметрами – 94°С – 45 секунд, 65°С – 45 секунд, 72°С – 45 секунд. После 28-го цикла проводят инкубацию при 72°С в течение 7 минут.

Последующую амплификацию необходимых фрагментов ДНК проводят посредством оригинальных олигонуклеотидных праймеров FYCO1 с помощью ПЦР в стандартных термоциклерах (условия постановки ПЦР приведены в таблице):

№1- (F)5'TTGGCCTGCCGGAGCTCTT3'(19 п.н.),

№2- (R)5'AGTGACCTGGAGGAGCAGAAGAAGCAGCGCATT3'(33п.н.).

При этом отличительной особенностью оригинального дизайна олигонуклеотидных праймеров является структура так называемого мисс-матч праймера, содержащая 33 нуклеотида в последовательности, в которой один нуклеотид (А-аденин) замещен на другой (С-цитозин) (см. фиг. 2). Конструкция обратного мисс-матч праймера позволяет создавать «искусственный» сайт узнавания для эндонуклеазы рестрикции PstI, поскольку в нативной последовательности ДНК человека в 8-м экзоне гена FYCO1 в области обнаруженной мутации с.1621C>T естественный сайт рестрикции для известных эндонуклеаз отсутствует.

Далее проводят ПДРФ анализ, к амплификату добавляют эндонуклеазу рестрикции и смесь буферных растворов в соответствии с рекомендациями производителя и инкубируют полученную смесь при температуре 37°C в течение 12 часов. После этого проводят электрофоретическое разделение продуктов гидролиза в 4%-ном агарозном геле с бромистым этидием в 0,5% трис-ацетатном буферном растворе в течение 30-40 минут при напряжении поля в 100 В.

В последующем продукты гидролиза, нанесенные на гель, визуализируют с помощью системы гель-видеодокументации в УФ-свете.

При этом наличие на электрофореграмме одного визуализируемого бэнда в 270 п.н. будет указывать на наличие мутации с.1621C>T в гомозиготном состоянии, наличие двух визуализируемых бэндов в 270 п.н. и 243 п.н. будет свидетельствовать о наличие мутации в гетерозиготном состоянии (гетерозиготное носительство у здоровых индивидов), наличие одного визуализирумего бэнда размером в 243 п.н. будет указывать на отсутствие данной мутации (см. фиг. 3).

Таким образом, общая продолжительность исследования составляет не более 4 суток.

Заявленный способ ДНК-диагностики был апробирован с помощью молекулярно-генетического анализа на наличие данной мутации в 32 семьях с врожденной катарактой, с последующей верификацией результатов с помощью прямого секвенирования по Сэнгеру. При этом в 28 семьях из общего числа обследованных, у пораженных индивидов мутация с.1621C>T в гене FYCO1 была идентифицирована в гомозиготном состоянии и сегрегировала с фенотипами обследованных здоровых родственников (была обнаружена либо в гетерозиготном состоянии, либо отсутствовала).

Проведенный молекулярно-генетический анализ показал, что вклад CTRCT18 в Якутии составил 87,5 %. Таким образом, проведенный молекулярно-генетический анализ позволил провести дифференциальную диагностику аутосомно-рецессивной катаракты (CTRCT18) в 32 обследованных семей. Последующая верификация всех полученных результатов с помощью прямого секвенирования по Сэнгеру фрагмента 8 экзона гена FYCO1 не выявила ложноположительных и ложноотрицательных результатов, специфичность метода составила 100 %. Ниже приведены примеры проведенного ДНК-тестирования.

Пример 1. Семья №1, пациент (шифр 779) 1990 года рождения, пол мужской, якут, диагноз - врожденная катаракта, наследственность отягощена (есть два брата и сестра с врожденной катарактой). Образец ДНК пациента экстрагирован и очищен по стандартной методике из периферической крови. В результате молекулярно-генетического исследования на наличие мутации c.1621C>T (p.Gln541Ter) гена FYCO1 (аутосомно-рецессивная катаракта, CTRCT18 каталог OMIM #610019) предложенным способом ПЦР-ПДРФ анализа с использованием оригинальной последовательности олигонуклеотидных праймеров и эндонуклеазы рестрикции PstI c последующим электрофоретическим разделением продуктов гидролиза в 4%-ном агарозном геле и визуализацией с помощью системы гель-видеодокументации у обследуемого обнаружена мутация с.1621C>T (p.Gln541Ter) в гомозиготном состоянии, что подтверждает диагноз наследственной аутосомно-рецессивной катаракты (CTRCT18 каталог OMIM #610019). Рекомендуется: ДНК-тестирование близких родственников (супруг/супруга, родители/дети, братья/сестры и др.) и консультация врача-генетика при планировании семьи.

Продолжительность исследования составила 4 суток. Полученный результат верифицирован с помощью прямого секвенирования фрагмента 8-го экзона гена FYCO1 по Сэнгеру.

Пациент (шифр 780) 1992 года рождения, пол женский, якутка, диагноз - врожденная катаракта, наследственность отягощена (сестра пациента 779, есть два брата с врожденной катарактой). Образец ДНК пациента экстрагирован и очищен по стандартной методике из периферической крови. В результате молекулярно-генетического исследования на наличие мутации c.1621C>T (p.Gln541Ter) гена FYCO1 (аутосомно-рецессивная катаракта, CTRCT18 каталог OMIM #610019) предложенным способом ПЦР-ПДРФ анализа с использованием оригинальной последовательности олигонуклеотидных праймеров и эндонуклеазы рестрикции PstI c последующим электрофоретическим разделением продуктов гидролиза в 4%-ном агарозном геле и визуализацией с помощью системы гель-видеодокументации у обследуемой обнаружена мутация с.1621C>T (p.Gln541Ter) в гомозиготном состоянии, что подтверждает диагноз наследственной аутосомно-рецессивной катаракты (CTRCT18 каталог OMIM #610019). Рекомендуется: ДНК-тестирование близких родственников (супруг/супруга, родители/дети, братья/сестры и др.) и консультация врача генетика при планировании семьи.

Продолжительность исследования составила 4 суток. Полученный результат верифицирован с помощью прямого секвенирования фрагмента 8-го экзона гена FYCO1 по Сэнгеру.

Пациент (шифр 781) 2009 года рождения, пол мужской, якут, диагноз - врожденная катаракта, наследственность отягощена (брат пациента 779, есть брат и сестра с врожденной катарактой). Образец ДНК пациента экстрагирован и очищен по стандартной методике из периферической крови. В результате молекулярно-генетического исследования на наличие мутации c.1621C>T (p.Gln541Ter) гена FYCO1 (аутосомно-рецессивная катаракта, CTRCT18 каталог OMIM #610019) предложенным способом ПЦР-ПДРФ анализа с использованием оригинальной последовательности олигонуклеотидных праймеров и эндонуклеазы рестрикции PstI c последующим электрофоретическим разделением продуктов гидролиза в 4%-ном агарозном геле и визуализацией с помощью системы гель-видеодокументации у обследуемого обнаружена мутация с.1621C>T (p.Gln541Ter) в гомозиготном состоянии, что подтверждает диагноз наследственной аутосомно-рецессивной катаракты (CTRCT18 каталог OMIM #610019). Рекомендуется: ДНК-тестирование близких родственников (супруг/супруга, родители/дети, братья/сестры и др.) и консультация врача генетика при планировании семьи.

Продолжительность исследования составила 4 суток. Полученный результат верифицирован с помощью прямого секвенирования фрагмента 8-го экзона гена FYCO1 по Сэнгеру.

Мать обследованных пациентов (шифр 782) 1970 года рождения, якутка, здорова, наследственность отягощена (трое детей с врожденной катарактой). Образец ДНК обследуемой экстрагирован и очищен по стандартной методике из периферической крови. В результате молекулярно-генетического исследования на наличие мутации c.1621C>T (p.Gln541Ter) гена FYCO1 (аутосомно-рецессивная катаракта, CTRCT18 каталог OMIM #610019) предложенным способом ПЦР-ПДРФ анализа с использованием оригинальной последовательности олигонуклеотидных праймеров и эндонуклеазы рестрикции PstI c последующим электрофоретическим разделением продуктов гидролиза в 4%-ном агарозном геле и визуализацией с помощью системы гель-видеодокументации у обследуемой обнаружена мутация с.1621C>T (p.Gln541Ter) в гетерозиготном состоянии, что подтверждает статус гетерозиготного носительства аутосомно-рецессивной катаракты (CTRCT18 каталог OMIM #610019). Рекомендуется: ДНК-тестирование близких родственников (супруг/супруга, родители/дети, братья/сестры и др.) и консультация врача генетика при планировании семьи.

Продолжительность исследования составила 4 суток. Полученный результат верифицирован с помощью прямого секвенирования фрагмента 8-го экзона гена FYCO1 по Сэнгеру.

Отец обследованных пациентов (шифр 783) 1968 года рождения, якут, здоров, наследственность отягощена (трое детей с врожденной катарактой). Образец ДНК обследуемого экстрагирован и очищен по стандартной методике из периферической крови. В результате молекулярно-генетического исследования на наличие мутации c.1621C>T (p.Gln541Ter) гена FYCO1 (аутосомно-рецессивная катаракта, CTRCT18 каталог OMIM #610019) предложенным способом ПЦР-ПДРФ анализа с использованием оригинальной последовательности олигонуклеотидных праймеров и эндонуклеазы рестрикции PstI c последующим электрофоретическим разделением продуктов гидролиза в 4%-ном агарозном геле и визуализацией с помощью системы гель-видеодокументации у обследуемого обнаружена мутация с.1621C>T (p.Gln541Ter) в гетерозиготном состоянии, что подтверждает статус гетерозиготного носительства аутосомно-рецессивной катаракты (CTRCT18 каталог OMIM #610019). Рекомендуется: ДНК-тестирование близких родственников (супруг/супруга, родители/дети, братья/сестры и др.) и консультация врача генетика при планировании семьи.

Продолжительность исследования составила 4 суток. Полученный результат верифицирован с помощью прямого секвенирования фрагмента 8-го экзона гена FYCO1 по Сэнгеру.

Пример 2. Семья №2, пациент (шифр 860) 1998 года рождения, пол мужской, якут, диагноз - врожденная катаракта, наследственность отягощена, есть однояйцовый брат-близнец с врожденной катарактой. Образец ДНК пациента экстрагирован и очищен по стандартной методике из периферической крови. В результате молекулярно-генетического исследования на наличие мутации c.1621C>T (p.Gln541Ter) гена FYCO1 (аутосомно-рецессивная катаракта, CTRCT18 каталог OMIM #610019) предложенным способом ПЦР-ПДРФ анализа с использованием оригинальной последовательности олигонуклеотидных праймеров и эндонуклеазы рестрикции PstI c последующим электрофоретическим разделением продуктов гидролиза в 4%-ном агарозном геле и визуализацией с помощью системы гель-видеодокументации у обследуемого обнаружена мутация с.1621C>T (p.Gln541Ter) в гомозиготном состоянии, что подтверждает диагноз наследственной аутосомно-рецессивной катаракты (CTRCT18 каталог OMIM #610019). Рекомендуется: ДНК-тестирование близких родственников (супруг/супруга, родители/дети, братья/сестры и др.) и консультация врача генетика при планировании семьи.

Продолжительность исследования составила 4 суток. Полученный результат верифицирован с помощью прямого секвенирования фрагмента 8-го экзона гена FYCO1 по Сэнгеру.

Пациент (шифр 861) 1998 года рождения, пол мужской, якут, диагноз - врожденная катаракта, наследственность отягощена (есть однояйцовый брат-близнец с врожденной катарактой - 860). Образец ДНК пациента экстрагирован и очищен по стандартной методике из периферической крови. В результате молекулярно-генетического исследования на наличие мутации c.1621C>T (p.Gln541Ter) гена FYCO1 (аутосомно-рецессивная катаракта, CTRCT18 каталог OMIM #610019) предложенным способом ПЦР-ПДРФ анализа с использованием оригинальной последовательности олигонуклеотидных праймеров и эндонуклеазы рестрикции PstI c последующим электрофоретическим разделением продуктов гидролиза в 4%-ном агарозном геле и визуализацией с помощью системы гель-видеодокументации у обследуемого обнаружена мутация с.1621C>T (p.Gln541Ter) в гомозиготном состоянии, что подтверждает диагноз наследственной аутосомно-рецессивной катаракты (CTRCT18 каталог OMIM #610019). Рекомендуется: ДНК-тестирование близких родственников (супруг/супруга, родители/дети, братья/сестры и др.) и консультация врача генетика при планировании семьи.

Продолжительность исследования составила 4 суток. Полученный результат верифицирован с помощью прямого секвенирования фрагмента 8-го экзона гена FYCO1 по Сэнгеру.

Родная сестра пациентов (шифр 862), 2001 года рождения, пол женский, якутка, здорова, наследственность отягощена (есть братья-близнецы с врожденной катарактой - 860 и 861). Образец ДНК обследуемой экстрагирован и очищен по стандартной методике из периферической крови. В результате молекулярно-генетического исследования на наличие мутации c.1621C>T (p.Gln541Ter) гена FYCO1 (аутосомно-рецессивная катаракта, CTRCT18 каталог OMIM #610019) предложенным способом ПЦР-ПДРФ анализа с использованием оригинальной последовательности олигонуклеотидных праймеров и эндонуклеазы рестрикции PstI c последующим электрофоретическим разделением продуктов гидролиза в 4%-ном агарозном геле и визуализацией с помощью системы гель-видеодокументации у обследуемой мутации с.1621C>T (p.Gln541Ter) не обнаружено, что не подтверждает статус гетерозиготного носительства аутосомно-рецессивной катаракты (CTRCT18 каталог OMIM #610019).

Продолжительность исследования составила 4 суток. Полученный результат верифицирован с помощью прямого секвенирования фрагмента 8-го экзона гена FYCO1 по Сэнгеру.

Пример 3. Семья №3, пациент (шифр 819) 2004 года рождения, пол мужской, якут, диагноз - врожденная катаракта, наследственность не отягощена, артефакия на левом глазу, афакия на правом глазу. Образец ДНК пациента экстрагирован и очищен по стандартной методике из периферической крови. В результате молекулярно-генетического исследования на наличие мутации c.1621C>T (p.Gln541Ter) гена FYCO1 (аутосомно-рецессивная катаракта, CTRCT18 каталог OMIM #610019) предложенным способом ПЦР-ПДРФ анализа с использованием оригинальной последовательности олигонуклеотидных праймеров и эндонуклеазы рестрикции PstI c последующим электрофоретическим разделением продуктов гидролиза в 4%-ном агарозном геле и визуализацией с помощью системы гель-видеодокументации у обследуемого обнаружена мутация с.1621C>T (p.Gln541Ter) в гомозиготном состоянии, что подтверждает диагноз наследственной аутосомно-рецессивной катаракты (CTRCT18 каталог OMIM #610019). Рекомендуется: ДНК-тестирование близких родственников (супруг/супруга, родители/дети, братья/сестры и др.) и консультация врача генетика при планировании семьи.

Продолжительность исследования составила 4 суток. Полученный результат верифицирован с помощью прямого секвенирования фрагмента 8-го экзона гена FYCO1 по Сэнгеру.

Пример 4. Семья №4, пациент (шифр 823) 2006 года рождения, пол женский, якутка, диагноз - врожденная катаракта, наследственность не отягощена, артефакия на оба глаза. Образец ДНК пациента экстрагирован и очищен по стандартной методике из периферической крови. В результате молекулярно-генетического исследования на наличие мутации c.1621C>T (p.Gln541Ter) гена FYCO1 (аутосомно-рецессивная катаракта, CTRCT18 каталог OMIM #610019) предложенным способом ПЦР-ПДРФ анализа с использованием оригинальной последовательности олигонуклеотидных праймеров и эндонуклеазы рестрикции PstI c последующим электрофоретическим разделением продуктов гидролиза в 4%-ном агарозном геле и визуализацией с помощью системы гель-видеодокументации у обследуемой обнаружена мутация с.1621C>T (p.Gln541Ter) в гомозиготном состоянии, что подтверждает диагноз наследственной аутосомно-рецессивной катаракты (CTRCT18 каталог OMIM #610019). Рекомендуется: ДНК-тестирование близких родственников (супруг/супруга, родители/дети, братья/сестры и др.) и консультация врача генетика при планировании семьи.

Продолжительность исследования составила 4 суток. Полученный результат верифицирован с помощью прямого секвенирования фрагмента 8-го экзона гена FYCO1 по Сэнгеру.

Пример 5. Семья №5, пациент (шифр 823) 1998 года рождения, пол женский, якутка, диагноз - врожденная катаракта, наследственность не отягощена, артефакия на оба глаза. Образец ДНК пациента экстрагирован и очищен по стандартной методике из периферической крови. В результате молекулярно-генетического исследования на наличие мутации c.1621C>T (p.Gln541Ter) гена FYCO1 (аутосомно-рецессивная катаракта, CTRCT18 каталог OMIM #610019) предложенным способом ПЦР-ПДРФ анализа с использованием оригинальной последовательности олигонуклеотидных праймеров и эндонуклеазы рестрикции PstI c последующим электрофоретическим разделением продуктов гидролиза в 4%-ном агарозном геле и визуализацией с помощью системы гель-видеодокументации у обследуемой обнаружена мутация с.1621C>T (p.Gln541Ter) в гомозиготном состоянии, что подтверждает диагноз наследственной аутосомно-рецессивной катаракты (CTRCT18 каталог OMIM #610019). Рекомендуется: ДНК-тестирование близких родственников (супруг/супруга, родители/дети, братья/сестры и др.) и консультация врача генетика при планировании семьи.

Продолжительность исследования составила 4 суток. Полученный результат верифицирован с помощью прямого секвенирования фрагмента 8-го экзона гена FYCO1 по Сэнгеру.

Таким образом, заявленный способ с использованием оригинальной последовательности олигонуклеотидных праймеров (конструкция одного из которых имеет «искусственную» замену аденина на цитозин) позволяет создать сайт рестрикции для эндонуклеазы PstI и при электрофоретическом разделении продуктов гидролиза в агарозном геле с последующей визуализацией в ультрафиолетовом свете детектировать с высокой точностью наличие у человека нонсенс-мутации с.1621C>T (p.Gln541Ter) в гене FYCO1, что, в относительно короткие сроки (средняя продолжительность исследования 4 суток), делает возможным получение достоверных результатов молекулярно-генетической диагностики врожденной формы аутосомно-рецессивной катаракты (CTRCT18), распространенной в Якутии.

Таблица

Условия детекции мутации с.1621C>T (p.Gln541Ter)

Ген Последовательность праймеров от 5’ → 3’ конца ПЦР ПДРФ-анализ Электрофорез
FYCO1 №1- F- TGGCCTGCCGGAGCTCTT
№2- R-AGTGACCTGGAGGAGCAGAAGAAGCAGCGCATT
Раунд 1. 95°С – 5 мин
Раунд 2. 95°С - 45 с
65°С - 45 с
72°С - 45 с
Раунд 3. 72°С - 7 мин
Раунд 4. 10°С - 5 мин (охлаждение).
Раунд 2 повторяется 28 раз
1. Обработка амплификатов эндонуклеазой рестрикции PstI
(GAATGCN↑)
2. Инкубация при 37°С в течение 12 часов.
Электрофоретическое разделение в 4% агарозном геле с бромистым этидием и визуализацией в УФ-свете.

Способ ДНК-диагностики врожденной формы катаракты, включающий выделение образцов ДНК, тестируемых из периферической крови, амплификацию фрагментов ДНК с помощью специфических пар олигонуклеотидных праймеров (F)5'TTGGCCTGCCGGAGCTCTT3', (R)5'AGTGACCTGGAGGAGCAGAAGAAGCAGCGCATT3' и обработку полученных амплификатов эндонуклеазой рестрикции PstI с последующей детекцией мутации с.1621C>T (p.Gln541Ter) гена FYCO1 в ультрафиолетовом свете после электрофоретического разделения продуктов гидролиза в агарозном геле.
Способ ДНК-диагностики врожденной формы катаракты (CTRCT18)
Способ ДНК-диагностики врожденной формы катаракты (CTRCT18)
Источник поступления информации: Роспатент

Показаны записи 1-10 из 50.
13.01.2017
№217.015.8b6f

Способ повышения психофизиологического состояния организма спортсменов массовых видов спорта

Изобретение относится к фармацевтической промышленности, а именно к способу повышения психофизиологического состояния организма спортсменов массовых видов спорта. Способ заключается в поэтапном приеме поликомпонентных биопрепаратов. Биопрепарат на основе слоевищ лишайников рода Cladonia и...
Тип: Изобретение
Номер охранного документа: 0002604126
Дата охранного документа: 10.12.2016
29.12.2017
№217.015.f60f

Способ снижения риска развития некроза конечностей при холодовой травме

Изобретение относится к медицине, а именно, к хирургии, и может быть использовано для лечения холодовых травм, в том числе отморожений. Способ включает наложение теплоизолирующей повязки на пораженные конечности, проведение медикаментозной и инфузионной терапии. При этом в дореактивном периоде...
Тип: Изобретение
Номер охранного документа: 0002637086
Дата охранного документа: 29.11.2017
19.01.2018
№218.016.0cec

Способ получения полимерных композиций на основе политетрафторэтилена, содержащих минеральный наполнитель

Изобретение относится к способу получения композиционных полимерных материалов, которые могут быть использованы для изготовления уплотнительных деталей. Способ получения полимерных композиций на основе политетрафторэтилена включает предварительное диспергирование минерального наполнителя...
Тип: Изобретение
Номер охранного документа: 0002632843
Дата охранного документа: 10.10.2017
19.01.2018
№218.016.0d28

Способ формирования заряда взрывчатого вещества в скважине

Изобретение относится к горной промышленности и может быть использовано при взрывной скважинной отбойке горных пород на открытых горных работах. Заряжание скважин производят с рассредоточением зарядов на основные и промежуточные. При этом основной заряд размещают на дне скважины в четырех...
Тип: Изобретение
Номер охранного документа: 0002632987
Дата охранного документа: 11.10.2017
20.01.2018
№218.016.0f99

Способ бромирования поверхности порошка свмпэ

Изобретение относится к способу бромирования поверхности порошка сверхвысокомолекулярного полиэтилена (СВМПЭ). Способ включает приготовление раствора галогена в низкокипящем органическом растворителе с последующим бромированием поверхности СВМПЭ с использованием ультрафиолетового излучения в...
Тип: Изобретение
Номер охранного документа: 0002633523
Дата охранного документа: 13.10.2017
10.05.2018
№218.016.387f

Способ ведения буровзрывных работ в трещиноватых породах

Изобретение относится к горнодобывающей промышленности и создано применительно к ведению буровзрывных работ при открытой разработке месторождений полезных ископаемых в условиях трещиноватых пород криолитозоны Севера. Буровзрывные работы в трещиноватых породах ведутся рассредоточенными зарядами...
Тип: Изобретение
Номер охранного документа: 0002646887
Дата охранного документа: 12.03.2018
10.05.2018
№218.016.458a

Способ криогенного концентрирования радона

Изобретение относится к способу криогенного концентрирования радона. Способ включает охлаждение выделяемого из эманирующего радиоактивного источника газообразного радона до отрицательных температур с использованием установки, содержащей теплоизолированную емкость с заливным патрубком,...
Тип: Изобретение
Номер охранного документа: 0002650177
Дата охранного документа: 11.04.2018
10.05.2018
№218.016.489d

Способ лапароскопической резекции образования почки с суперселективной баллонной эмболизацией почечной артерии

Изобретение относится к медицине, в частности к онкологии, урологии, хирургии. Непосредственно перед лапароскопической операцией под рентген-контролем выполняют селективную почечную артериографию. При этом в артерию, питающую сегмент почки с опухолью, заводят коронарный баллон и раздувают до...
Тип: Изобретение
Номер охранного документа: 0002651055
Дата охранного документа: 18.04.2018
10.05.2018
№218.016.4a39

Способ отработки глубоких горизонтов карьера

Изобретение относится к горнодобывающей промышленности и создано применительно к отработке глубоких горизонтов карьеров с применением автомобильного транспорта. Техническим результатом является повышение эффективности отработки глубоких горизонтов карьера. Отработку глубоких горизонтов карьера...
Тип: Изобретение
Номер охранного документа: 0002651484
Дата охранного документа: 20.04.2018
10.05.2018
№218.016.4ebb

Способ криогенной обработки семян растений

Изобретение относится к области сельского хозяйства. Предложен способ криогенной обработки семян растений, включающий охлаждение семян до отрицательных температур и последующее их хранение или отогрев перед посевом при температуре 25-35°С. Предварительно упакованные в хлопчатобумажные мешочки...
Тип: Изобретение
Номер охранного документа: 0002650888
Дата охранного документа: 18.04.2018
Показаны записи 1-2 из 2.
29.05.2019
№219.017.6275

Способ выявления мутаций гена gjb2, обуславливающих аутосомно-рецессивную глухоту 1а типа

Изобретение относится к области медицины, в частности к медицинской генетике и оториноларингологии, и предназначено для выявления мутаций гена GJB2, обуславливающих аутосомно-рецессивную глухоту 1А типа. Предложен способ, включающий детекцию трех наиболее распространенных в Якутии мутаций...
Тип: Изобретение
Номер охранного документа: 0002688180
Дата охранного документа: 21.05.2019
24.07.2020
№220.018.35a5

Способ днк-диагностики аутосомно-рецессивной глухоты-103

Изобретение относится к области биотехнологии.Изобретение предназначено для выявления мутации c.1121G>А (p.Trp374*) гена СLIC5, обуславливающей аутосомно-рецессивную глухоту-103. Способ ДНК-диагностики аутосомно-рецессивной глухоты-103 (DFNB103), включающий детекцию нонсенс-мутации...
Тип: Изобретение
Номер охранного документа: 0002727684
Дата охранного документа: 22.07.2020

Похожие РИД в системе