20.03.2013
216.012.3026

Способ ранней диагностики послеродового эндометрита

Вид РИД

Изобретение

Юридическая информация Свернуть Развернуть
Краткое описание РИД Свернуть Развернуть
Аннотация: Изобретение относится к области медицины. Предложен способ ранней диагностики послеродового эндометрита, включающий выделение РНК из эпителиальных клеток цервикального канала у женщин на поздних сроках беременности или на 3-4 сутки после родов, проведение обратной транскрипции с получением кДНК и определение экспрессии мРНК TLR5 с помощью количественной полимеразной цепной реакции. Снижение экспрессии мРНК TLR5 ниже 0,01202 у женщин на поздних сроках беременности и ниже 0,16938 на 3-4 сутки после родов свидетельствует о развитии послеродового эндометрита. Изобретение обеспечивает диагностику послеродового эндометрита на поздних сроках беременности, что позволяет начать профилактику эндометрита сразу после рождения ребенка. 1 табл.
Основные результаты: Способ ранней диагностики послеродового эндометрита, включающий выделение РНК из эпителиальных клеток цервикального канала у женщин на поздних сроках беременности или на 3-4 сутки после родов, проведение обратной транскрипции с получением кДНК, определение экспрессии мРНК TLR5 с помощью количественной полимеразной цепной реакции и на основании снижения экспрессии мРНК TLR5 ниже 0,01202 у женщин на поздних сроках беременности и ниже 0,16938 на 3-4 сутки после родов диагностируют развитие послеродового эндометрита.
Реферат Свернуть Развернуть

Изобретение относится к области медицинской диагностики, может быть использовано для ранней диагностики послеродового эндометрита.

Послеродовые гнойно-воспалительные заболевания в настоящее время занимают одно из первых мест в структуре материнской заболеваемости и смертности [1]. Существующие на сегодня современные методы диагностики, профилактики и лечения послеродовых воспалительных осложнений недостаточно эффективны, число гнойно-септических осложнений остается стабильно высоким (5-26%), составляя 26% в структуре материнской смертности. Кроме того, послеродовые инфекционные заболевания напрямую влияют на репродуктивное здоровье женщины. Послеродовый эндометрит часто приводит к бесплодию и невынашиванию беременности. Акушерский перитонит, развившийся на фоне послеродового эндометрита, является показанием для экстирпации матки, что делает невозможным дальнейшее выполнение женщиной репродуктивной функции. Все это делает своевременную диагностику, профилактику и лечение послеродовых гнойно-септических заболеваний одной из ведущих задач в сохранении репродуктивного здоровья населения.

Причиной высокой частоты послеродовых гнойно-воспалительных заболеваний (ГВЗ) является также постоянное увеличение числа кесаревых сечений, в среднем на 1% в год. Вероятность развития послеродового эндометрита после кесарева сечения в 5-10 раз выше, чем после родов через естественные родовые пути, а после повторного кесарева сечения риск гнойно-воспалительных заболеваний увеличивается еще в 2,5 раза. При этом растет частота стертых и абортивных форм эндометрита (до 40% от общего числа), диагностика которых часто бывает затруднена из-за несоответствия общей реакции организма и степени тяжести местного патологического процесса [2, 3]. Метод УЗИ-исследования, который традиционно используется для диагностики признаков послеродового эндометрита (субинволюция матки), оказывается не всегда информативным. Существует так называемый "второй вариант" ультразвуковой картины послеродового эндометрита. Это базальный эндометрит с наличием гиперэхогенных отложений в стенке матки и невыраженной субинволюцией без образования лохиометры, который встречается в 28% случаев и чаще всего своевременно не диагностируется [4]. Бактериологическое исследование, которое наиболее часто используется в клинике, имеет существенный недостаток - фактор времени, так как его результаты врач, как правило, получает на 5-7 сутки, то есть после выписки пациентки из родильного дома. При этом степень обсемененности не всегда коррелирует с риском развития инфекционного процесса. Так, у одной пациентки эндометрит развивается при бактериальной обсемененности 104 КОЕ/мл, в то время как у другой для его развития достаточно 102 КОЕ/мл возбудителя. Поэтому для оценки риска ГВЗ было предложено определять показатели иммунореактивности организма.

Известен способ ранней диагностики эндометритов после кесарева сечения (RU №98103142/14, публ. 24.02.1998), основанный на определении в венозной крови родильницы в первые 3 суток после родов уровня цитокинов ИЛ-1α, ИЛ-1β, ИЛ-8. Увеличение показателей провоспалительных цитокинов выше нормы свидетельствует о послеродовом эндометрите. Использование способа позволяет выявить развитие послеродового эндометрита у родильниц группы высокого инфекционного риска на ранней стадии.

Известен способ диагностики субклинической формы послеродового эндометрита (RU №2007105844/15, публ. 16.02.2007), включающий определение уровня провоспалительных интерлейкинов в венозной крови родильницы, в первые 3 суток после родов определяют уровень индуцированных ФНО-α и ИЛ-6 и при ФНО-α более 1024 пг/мл, ИЛ-6 более 4077 пг/мл диагностируют послеродовый эндометрит, а также спонтанный и индуцированный ИЛ-4 и при величине сывороточного ИЛ-4 более 837 пг/мл, спонтанного ИЛ-4 51 индуцированного ИЛ-4 более 46 пг/мл диагностируют послеродовый эндометрит.

Однако эти способы являются неспецифическими для послеродового эндометрита, так как повышение уровней цитокинов возможно при любых воспалительных процессах другой локализации.

Известен способ диагностики послеродовых эндометритов (RU 2004118386/15, публ. 17.06.2004), включающий в себя исследование показателей кинин-калликреиновой системы плазмы крови. При повышении спонтанной эстеразной активности и при понижении прекалликреина и ингибитора калликреина диагностируют послеродовый эндометрит. Способ обеспечивает раннюю диагностику осложнений послеродового периода в среднем на 4 сутки до изменений, определяемых по данным УЗИ. Данный способ можно использовать только в послеродовом периоде, что не дает достаточного времени для проведения профилактических мероприятий. Кроме того, он также не является специфическим именно для послеродового эндометрита.

Также существует способ ранней диагностики послеродового эндометрита (RU 96101677/14, публ. 30.01.1996), включающий лабораторный анализ метроаспирата через сутки после родоразрешения, в содержимом из полости матки определяют уровень ДНК-азы и при повышении этого показателя по сравнению с контролем диагностируют послеродовый эндометрит. Данный способ является инвазивным и технически сложным.

Известен способ диагностики хронического эндометрита и характера воспаления (RU 2003104391/15, публ. 10.02.2003), включающий клинико-морфологическое обследование иммуногистоцитохимическим методом, в ткани эндометрия определяют показатели местного иммунитета: количество лимфоцитов, экспрессирующих маркеры естественных киллерных клеток CD56+, CD16+ и маркеры активации HLA-DR(II)+, при этом подсчет осуществляют в световом микроскопе при увеличении объектива ×40, окуляра ×10 в трех полях зрения. При количестве клеток, экспрессирующих CD56+, CD16+, HLA-DR(II)+ от 0 до 10 в поле зрения, диагностируют отсутствие эндометрита, при количестве клеток, экспрессирующих CD56+ выше 10, и при количестве клеток, экспрессирующих CD16+ и HLA-DR(II)+ от 0 до 10 в поле зрения, диагностируют аутоиммунный хронический эндометрит, при количестве клеток, экспрессирующих CD56+, CD16+, HLA-DR(II)+ выше 10 в поле зрения, диагностируют обострение аутоиммунного хронического эндометрита, при количестве клеток, экспрессирующих CD16+ и HLA-DR(II)+ выше 10, и при количестве клеток, экспрессирующих CD56+ от 0 до 10 в поле зрения, диагностируют хронический эндометрит с обострением или острый эндометрит, при количестве клеток, экспрессирующих CD16+, CD56+ выше 10, и при количестве клеток, экспрессирующих HLA-DR(II)+ от 0 до 10 в поле зрения, диагностируют хроническое воспаление с аутоиммунным компонентом, но без активации процесса, при количестве клеток, экспрессирующих CD16+ выше 10, и при количестве клеток, экспрессирующих CD56+ и HLA-DR(II)+ от 0 до 10 в поле зрения, диагностируют хронический эндометрит.

Недостатком данного способа является его инвазивность и сложность получения ткани эндометрия, в связи с чем сбор материала должен осуществлять врач, а также его трудоемкость (для работы возможно использование только свежего материала, отсутствие возможности для его хранения).

Кроме того, в известных источниках информации предлагают использовать измерение парциального давления кислорода и углекислого газа, pH лохий [5]. Эти методы также имеют низкую специфичность. Использование газовой хроматографии и масс-спектрометрии для выявления сигнальных соединений "quorum sensing" (чувства кворума) микроорганизмов считается высокоинформативным методом для скринингового исследования на ГВЗ [6], однако использование этих методов недоступно даже в большинстве областных клиник из-за отсутствия дорогостоящего оборудования и высокой стоимости исследования.

Выбор определения экспрессии Толл-подобного рецептора 5 (TLR5) в качестве диагностического способа при послеродовых гнойно-септических заболеваниях связан с высокой специфичностью способа, так как он распознает один из бактериальных лигандов - флагеллин бактерий.

Эпителиальные клетки женских половых путей экспрессируют 10 типов TLR, каждый из которых связывается только со специфическими лигандами, представляющими собой части клеточной стенки бактерий, грибов, ДНК или РНК вирусов. Распознавание бактериальных структур (липополисахаридов, липопротеина, флагеллина и т.д.) происходит через активацию TLR 1, 2, 4, 5 и 6. Четыре Толл-подобных рецептора способны распознавать нуклеиновые кислоты - это TLR 3, 7, 8 и 9. TLR7 и TLR 8 распознают собственную и вирусную одноцепочечную РНК, а TLR 9 связывает неметилированную ДНК бактерий. TLR 3 способен распознавать двухцепочечную РНК вирусов, поэтому данный рецептор играет ключевую роль в противовирусном иммунном ответе [7, 8, 9, 10, 11].

Связывание TLR с лигандом приводит к выработке цитокинов и антимикробных пептидов [12].

Задачей изобретения является разработка способа ранней диагностики послеродового эндометрита на основании определения экспрессии мРНК TLR5.

Технический результат - получение критериев для диагностики послеродового эндометрита, позволяющих как можно раньше начать антибактериальную терапию и тем самым снизить экономические затраты и уменьшить количество койко-дней пребывания пациенток в послеродовом отделении.

В соответствии с поставленной задачей был разработан способ ранней диагностики послеродового эндометрита, основанный на определении экспрессии мРНК TLR5, включающий:

- выделение рибонуклеиновой кислоты (РНК) из эпителиальных клеток цервикального канала у женщин на поздних сроках беременности или на 3-4 сутки после родов;

- обратную транскрипцию с получением комплементарной дезоксирибонуклеиновой кислоты (кДНК);

- определение экспрессии мРНК TLR5 с помощью количественной полимеразной цепной реакции;

- диагностику на основании снижения экспрессии мРНК TLR5 ниже 0,01202 у женщин на поздних сроках беременности и ниже 0,16938 на 3-4 сутки после родов развитие послеродового эндометрита.

Новизна и изобретательский уровень заключается в том, что в настоящее время не известна возможность ранней диагностики послеродового эндометрита на основании определения экспрессии мРНК TLR5.

Способ осуществляют следующим образом.

Материалом для определения экспрессии Толл-подобного рецептора 5 с целью диагностики послеродовых гнойно-септических заболеваний являются клетки эпителия цервикального канала. Способ разработан с учетом стандарта MIQE (Bustin S.A. et al., 2009) [13].

Взятие материала у беременных женщин на доношенном сроке беременности или на 3-4 сутки послеродового периода. Шейку матки обнажают в зеркалах, стерильным тампоном удаляют слизь из цервикального канала. Затем с помощью цитощетки производят сбор материала в пробирку Эппендорфа объемом 1,5 мл, содержащую 500 мкл консервирующей среды RNAlater (Ambion).

Если есть необходимость в хранении материала, после помещения материала в раствор RNAlater пробирки оставляют в холодильнике при температуре +4°C на 1 сутки, затем помещают в морозильную камеру и в дальнейшем хранят при температуре - 28°C. После размораживания образцов сливают надосадочную жидкость и приступают к выделению РНК.

Выделение РНК проводят методом фенол-хлороформной экстракции с использованием реагента Тризол (“Invitrogen”), описанным производителем.

1. К осадку, полученному при центрифугировании, добавляют 10 частей Тризола (1000 мкл), инкубируют в течение 5 минут при температуре 25°C, во время чего происходит лизис клеток и полная диссоциация нуклеопротеинового комплекса. После этого образцы центрифугируют при 12000 об/мин 10 мин при температуре от +2 до +8°C.

2. В пробирку добавляют 200 мкл хлороформа, после чего встряхивали смесь в течение 15 секунд и центрифугировали при 12000 об/мин 15 мин при температуре от +2 до +8°C. После центрифугирования в пробирке образуется нижняя фенол-хлороформная фаза (окрашенная в малиновый цвет), содержащая ДНК, интерфаза, состоящая из белков, и бесцветная водная фаза, в которой содержится РНК. Объем водной фазы составляет около 60% от объема Тризола.

3. Преципитация РНК. Водную фазу переносят в стерильные пробирки, преципитацию РНК производят путем добавления 500 мкл изопропилового спирта, затем инкубируют при температуре (+15) - (+30)°C в течение 10 мин, центрифугируют при 12000 об/мин 10 мин при температуре от +2 до +8°C. После центрифугирования РНК образует бесцветный гелеобразный шарик на дне пробирки.

4. После удаления надосадочной жидкости РНК отмывают добавлением 1000 мкл холодного 75% этилового спирта, центрифугировали при 7500 об/мин 5 мин при температуре от +2 до +8°C.

5. Полученную РНК подсушивают на воздухе при комнатной температуре в течение 5-10 минут, затем разбавляли стерильной водой, свободной от РНКаз (водой с добавлением DEPC), инкубировали при +55°C в течение 10 минут.

Полученная РНК может быть заморожена в 75% этиловом спирте при температуре - 80°C в течение длительного времени.

Качество РНК проверяют методом электрофореза в течение 15 минут при напряжении 10 V/см по интенсивности свечения полос рибосомальной РНК в 1,1% стандартном агарозном геле с бромистым этидием.

Для удаления геномной ДНК обрабатывают образцы ДНКазой DNAse I RNAse free ("Fermentas").

В стерильную пробирку добавляют:

1) 1 мкг РНК

2) 1 мкл 10Хбуфера с хлоридом магния

3) ДНКазу I (1 мкл=1 ед.)

4) воду, свободную от РНКаз (обработанную DEPC) - до 10 мкл.

Смесь инкубируют при температуре +37°C в течение 30 минут, затем добавляют 1 мкл 50 мМ ЭДТА и инкубируют при +65°C в течение 10 минут. Препарат РНК используют для обратной транскрипции.

Для обратной транскрипции в пробирке объемом 500 мкл смешивают:

1) 500 нг РНК, предварительно прогретой до 55 градусов (концентрацию мРНК проверяли на спектрофотометре Nanodrop ("ThermoScientific"), затем рассчитывали объем смеси, необходимый для добавления в реакцию);

2) 4 мкл oligoDT;

3) воды, свободной от РНКаз, - до 10 мкл.

Смесь прогревают при +70 градусах в течение 2 мин, затем переносят на лед.

В каждую пробирку добавляют по 8 мкл приготовленной смеси:

1) 4 мкл 5х MINT буфера для первой цепи,

2) 2 мкл dNTP,

3) 2 мкл смеси DTT (20 мМ).

После смешивания на вортексе добавляют по 2 мкл Mint ревертазы.

Поверх смеси наслаивают 1 каплю (15-20 мкл) минерального масла, чтобы объем смеси не изменился при испарении.

Смесь инкубируют при +42 градусах в амплификаторе в течение 1 часа 40 минут, после чего пробирки замораживают.

Для дальнейшей ПЦР использовали разведение полученной кДНК с водой в объеме 1 к 25.

Качество полученной кДНК оценивают с помощью гель-электрофореза в 1,1% агарозном геле с бромистым этидием.

Первая цепь кДНК может храниться до 3 месяцев при - 20°C, для более длительного хранения рекомендуется использовать - 70°C.

Для ПЦР в режиме реального времени был произведен подбор специфических праймеров в базе данных Blast (www.ncbi.nlm.nih.gov). Одним из условий поиска праймеров было отличие температуры амплификации прямого и обратного праймера не более 2°C.

Для количественной ПЦР в режиме реального времени использовали интеркалирующий краситель SYBR GREEN I.

Все полученные пары праймеров были протестированы на возможность образования «шпилек» и димеров с помощью программы Beacon Designer Free Edition (http://www.premierbiosoft.com/qOligo.jsp?PID=1). Кроме того, с целью тестирования на димеры праймеров в программу для ПЦР был добавлен этап анализа кривой плавления (melt curve). В качестве генов-нормировщиков использовали пептидилпропилизомеразу А (PPIA) и бета-актин.

Были выбраны следующие праймеры:

Наименование гена Прямой праймер 5'-3' Обратный праймер 5'-3' Температура отжига, °C
TLR5 GGGTCAGTTCTGGACTTCAGAG GGCTTCAAGGCACCAGCCATCTC 58
β-актин CAGGCACCAGGGCGTGATGG GATGGAGGGGCCGGACTCGT 64
PPIA CCGCCGAGGAAAACCGTGTACT TGGACAAGATGCCAGGACCCGT 64

Для ПЦР в режиме реального времени использовали смесь qPCRmix-HS SYBR с интеркалирующим красителем SYBR I («Евроген»), в который входит высокопроцессивная Taq-полимераза с горячим стартом, смесь нуклеотидтрифосфатов, магний и буферный раствор.

Для приготовления смеси на одну пробирку требуется:

2 мкл ДНК

2 мкл прямого праймера

2 мкл обратного праймера

5 мкл смеси qPCRmix-HS SYBR

14 мкл стерильной воды

Амплификацию проводили на амплификаторе I-cycler IQ5 (Biorad).

Режим амплификации для PPIA и TLR5:

1. Предварительная денатурация - 1 цикл 95°C 5 мин.

2. Денатурация - 1 цикл 95°C 30 сек.

3. Отжиг при соответствующей каждому праймеру температуре (см. таблицу) - 30 сек.

4. Элонгация при 68°C - 30 сек.

Режим амплификации для бета-актина:

1. Предварительная денатурация - 1 цикл 95°C 3 мин.

2. Денатурация - 1 цикл 95°C 15 сек.

3. Отжиг при 64°C - 30 сек.

4. Элонгация при 70°C - 30 сек.

Количество циклов - 50.

Полученные результаты выражали в относительных единицах (relative units), вычисляя их по формуле

R=2((Cq ref1+Cq ref2)/2-Cq target),

где R - уровень нормализованной экспрессии TLR5,

cq ref1 и cq ref2 - уровень экспрессии генов-нормировщиков (бета-актина и PPIA),

cq target - уровень экспрессии TLR5.

Возможность использования предложенного способа для ранней диагностики послеродового эндометрита подтверждена анализом результатов наблюдений 107 беременных на поздних сроках гестации и 104 пациенток в раннем послеродовом периоде (из них 48 - с признаками послеродового эндометрита, 56 - с нормально протекавшим послеродовым периодом). Диагноз послеродового эндометрита был подтвержден клинико-лабораторными данными, результатами УЗИ-исследования и гистологического исследования плаценты.

Были выявлены следующие уровни экспрессии мРНК TLR5 (Таблица 1).

Таблица 1
Экспрессия мРНК TLR5 на поздних сроках беременности и в раннем послеродовом периоде
Экспрессия мРНК TLR5 Послеродовый эндометрит (М±m) Нормальный послеродовый период (М±m)
На поздних сроках беременности 0,00862±0,0034 0,092±0,037
На 3-4 сутки после родов 0,06358±0,1058 0,2941±0,0445

Таким образом, уровень нормальной экспрессии мРНК TLR5 на поздних сроках беременности составляет от 0,0550 до 0,1290 относительных единиц, а в группе риска по развитию послеродового эндометрита - от 0,00522 до 0,01202 относительных единиц.

В раннем послеродовом периоде уровень экспрессии мРНК TLR5 составляет в норме от 0,2496 до 0,3386 относительных единиц, а у пациенток с начинающимся послеродовым эндометритом - от 0 до 0,16938 относительных единиц (p<0,05).

Таким образом, полученные данные свидетельствуют о том, что снижение экспрессии мРНК TLR5 можно считать фактором риска развития послеродового эндометрита.

Преимуществом предлагаемого способа является возможность определения мРНК TLR5 на поздних сроках беременности, что позволяет начать профилактику эндометрита сразу после рождения ребенка, кроме того, способ не требует больших затрат времени, прост в исполнении.

Список литературы

1. Горин B.C., Серов В.Н., Бирюкова Л.А., Степанов В.В. Оптимизация диагностики и лечения послеродового эндометрита // Российский вестник акушера-гинеколога. - 2009. - №1. - С.21-29.

2. Орджоникидзе Н.В., Федорова Т.А., Данелян С.Ж. Эндометрит и раневая инфекция у родильниц: проблемы и пути их решения. // Акушерство и гинекология. - 2004. - №5. - С.3-5.

3. Пекарев О.Г. Современные принципы профилактики и лечения острых неспецифических послеабортных и послеродовых метроэндометритов // Учебно-метод. пособие. - Новосибирск, 2004. - 28 с.

4. Логутова Л.С., Титченко Л.И., Новикова С.В. и др. Возможности использования новых ультразвуковых технологий в диагностике послеродовых осложнений // Российский вестник акушера-гинеколога. - 2007. - №5. - С.24-30.

5. Куперт М.А., Солодун П.В., Куперт А.Ф. Эндометрит после родов (группы риска, особенности клиники и диагностики) // Российский вестник акушера-гинеколога. - 2003. - Vol.4. - С.42-46.

6. Подзолкова Н.М., Истратов В.Г., Скворцова М.Ю., Шевелева Т.В. Возможность ранней диагностики послеродовых гнойно-септических осложнений с использованием хроматографии и масс-спектрометрического анализа // Материалы 8-го Российского форума «Мать и дитя». - М., 2006. - С.203-204.

7. Ахматова Н.К., Киселевский М.В. Врожденный иммунитет: противоопухолевый и противоинфекционный // М.: Практическая медицина, 2008. - 255 с.

8. Bowie A.G., Haga I.R. The role of Toll-like receptors in the host response to viruses // Molecular immunology. - 2005. - Vol.42, №8. - P.859-867.

9. Diebold S.S., Kashino Т., Hemmi H. et al. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA // Science. - 2004. - Vol.303, №5663. - P.1529-1531.

10. Hayashi F., Smith K.D., Ozinsky A. et al. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5 // Nature. - 2001. - Vol.410, №6832. - P.1099-1103.

11. Horne A., Stock S., King A. Innate immunity and disorders of female reproductive tract // Reproduction. - 2008. - Vol.135. - P.739-749.

12. Nasu K., Nahara H. Pattern recognition via Toll-like receptor system in the human female reproductive tract // Mediators and Inflammation. - 2010. - Vol.2010 - ID 976024. - 12 p.

13. Bustin S.A., Benes V., Garson G. et al. The MIQE Guidelines: Minimum information for publication of quantitive Real-Time PCR experiments // Clinical Chemistry. - 2009. - №55, Vol.4. - P.611-622.

Способ ранней диагностики послеродового эндометрита, включающий выделение РНК из эпителиальных клеток цервикального канала у женщин на поздних сроках беременности или на 3-4 сутки после родов, проведение обратной транскрипции с получением кДНК, определение экспрессии мРНК TLR5 с помощью количественной полимеразной цепной реакции и на основании снижения экспрессии мРНК TLR5 ниже 0,01202 у женщин на поздних сроках беременности и ниже 0,16938 на 3-4 сутки после родов диагностируют развитие послеродового эндометрита.
Источник поступления информации: Роспатент

Всего документов: 97
Всего документов: 138

Похожие РИД в системе

Защитите авторские права с едрид