15.10.2019
219.017.d5a7

Тест-система для идентификации видовой принадлежности баранины и говядины в продовольственном сырье, кормах и пищевых продуктах

Вид РИД

Изобретение

Юридическая информация Свернуть Развернуть
Краткое описание РИД Свернуть Развернуть
Аннотация: Изобретение относится к области биотехнологии. Изобретение представляет собой тест-систему для идентификации видовой принадлежности баранины и говядины в продовольственном сырье, кормах и пищевых продуктах, включающую пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, буфер для постановки реакции, смесь четырех дезоксинуклеотидтрифосфатов, специфичных для участка генома ДНК баранины (Ovis) и говядины (Bos) олигонуклеотидных праймеров, зондов, внутренний контрольный образец в виде суспензии бактериофага и положительных контрольных образцов, содержащих фрагменты геномов ДНК баранины (Ovis) и говядины (Bos), согласно изобретению для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×10 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца – смесь, содержащую фрагменты геномов баранины (Ovis), говядины (Bos) и бактериофага Т4, взятые в соотношении 1:1:1. Изобретение позволяет повысить точность идентификации видовой принадлежности говядины или баранины. 5 ил., 5 табл.
Реферат Свернуть Развернуть

Изобретение относится к ветеринарной микробиологии, в частности к наборам для определения видовой принадлежности мяса с помощью полимеразной цепной реакции с флуоресцентной детекцией в реальном времени.

Известен набор для определения видовой принадлежности тканей кур и свиней методом полимеразной цепной реакции содержащий комплект реагентов для экстракции ДНК из клинического материала, продуктов питания и кормов для животных; комплект реагентов для амплификации ДНК Gallus gallus и Sus scrofa; комплект реагентов для электрофоретической детекции продуктов амплификации в агарозном геле f https://docviewer.vandex.ru).

Также известен набор включающий пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, буфер для постановки реакции, смесь четырех дезоксинуклеотидтрифосфатов, специфичных для участка генома ДНК баранины (Ovis) и говядины (Bos) олигонуклеотидных праймеров, зондов, внутренний контрольный образец в виде суспензии бактериофага и положительных контрольных образцов - содержащих фрагменты геномов ДНК баранины (Ovis) и говядины (Bos), (Сорокина М.Ю. Автореферат диссертации по ветеринарии на тему Разработка тест-системы для определения видовой принадлежности мясных ингредиентов в кормах методом полимеразной цепной реакции, Москва, 2004 - прототип).

Однако известный набор используется для полимеразной цепной реакции с электрофоретической детекцией, в которой нуклеотидная последовательность непосредственно читается по электрофореграмме. Длина фрагмента, который может быть расшифрован этим методом, ограничивается разрешающей способностью метода гель-электрофореза, что влияет на точность диагностирования видовой принадлежности говядины или баранины в кормах.

Кроме того, отсутствует возможность идентификации видовой принадлежности баранины и говядины в продовольственном сырье и пищевых продуктах.

Техническим результатом является повышение точности идентификации видовой принадлежности говядины или баранины и расширение функциональных возможностей.

Технический результат достигается тем, что в тест-системе для идентификации видовой принадлежности баранины и говядины в продовольственном сырье, кормах и пищевых продуктах, включающем пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, буфер для постановки реакции, смесь четырех дезоксинуклеотидтрифосфатов, специфичных для участка генома ДНК баранины (Ovis) и говядины (Bos) олигонуклеотидных праймеров, зондов, внутренний контрольный образец в виде суспензии бактериофага и положительных контрольных образцов - содержащих фрагменты геномов ДНК баранины (Ovis) и говядины (Bos), согласно изобретению для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца – смесь, содержащую фрагменты геномов баранины (Ovis), говядины (Bos) и бактериофага Т4, взятые в соотношении 1:1:1 со следующими нуклеотидными последовательностями:

Ovis F GCCTCATCTCCCTCCAACAG прямой праймер

Ovis R CGGAAGCCTGTAATTACAGCTC обратный праймер

Ovis Р R6G-CTCATGTCTGTCCTTTGGTGTTATGAATGC-BHQ1 зонд

Bos F AACAGCATCATTCTACCCACTT прямой праймер

Bos R ACCTAAATTCCTATTCTAACACTG обратный праймер

Bos Р ROX-ACGACTTACATACTCCACTGCACTCACG-BHQ2 зонд

T4F TACATATAAATCACGCAAAGC

T4R TAGTATGGCTAATCTTATTGG

Т4Р CY5 ACATTGGCACTGACCGAGTTC.

Новизна заявляемой тест-системы заключается в том, что за счет существенных признаков, а именно:

- нуклеотидные последовательности праймеров и зонда;

- использование для внутреннего контрольного образца суспензию бактериофага Т4 с концентрацией 5×10 копий нуклеотидных последовательностей на 1 мкл, если концентрация копий нуклеотидных последовательностей отклоняется в большую или меньшую сторону, то наблюдаются повторности сомнительных образцов;

- использование для положительного контрольного образца - смесь содержащую фрагменты геномов баранины (Ovis), говядины (Bos) и бактериофага Т4 взятых в соотношении 1:1:1, обеспечивается с высокой точностью идентификация видовой принадлежности баранины и говядины наличие их ингредиентов в продовольственном сырье, кормах и пищевых продуктах.

Признаки, отличающие заявляемое техническое решение от прототипа, направлены на достижение технического результата и не выявлены при изучении данной и смежной областей науки и техники и, следовательно, соответствуют критерию «изобретательский уровень».

Заявляемый способ рекомендовано использовать в специализированных ветеринарных, санитарно-эпидемиологических, животноводческих, сельскохозяйственных предприятиях, что соответствует критерию «промышленная применимость».

Сущность изобретения поясняется чертежом, где на рисунках 1 - 5 представлены скриншоты с дисплея прибора Rotor-Gene Q: рис. 1 - представлен график канала Су5 для внутреннего контрольного образца (ВКО); рис. 2

- таблица количественных данных для Cycling A.Red (ВКО); рис. 3 - представлен график канала JOE/Yellow для специфического сигнала баранины (Ovis); рис. 4 - представлен график канала ROX/Orange - для говядины (Bos); рис. 5 - таблица количественных данных для Cycling A.Yellow (Ovis) и A.Orange (Bos).

Пример конкретного использования тест-системы для идентификации видовой принадлежности баранины и говядины в продовольственном сырье, кормах и пищевых продуктах.

Тест-система имеет пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, буфер для постановки реакции, смесь четырех дезоксинуклеотидтрифосфатов, специфичных для участка генома ДНК баранины (Ovis) и говядины (Bos) олигонуклеотидных праймеров, зондов, внутренний контрольный образец в виде суспензии бактериофага и положительных контрольных образцов - содержащих фрагменты геномов ДНК баранины (Ovis) и говядины (Bos). Для внутреннего контрольного образца использована суспензия бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца – смесь, содержащую фрагменты геномов баранины (Ovis), говядины (Bos) и бактериофага Т4, взятые в соотношении 1:1:1 со следующими нуклеотидными последовательностями:

Ovis F GCCTCATCTCCCTCCAACAG прямой праймер

Ovis R CGGAAGCCTGTAATTACAGCTC обратный праймер

Ovis Р К6О-СТСАТОТСТОТССТТТООТОТТАТОААТСС-BHQ1 зонд

Bos F AACAGCATCATTCTACCCACTT прямой праймер

Bos R ACCTAAATTCCTATTCTAACACTG обратный праймер

Bos Р ROX-ACGACTTACATACTCCACTGCACTCACG-BHQ2 зонд

T4F TACATATAAATCACGCAAAGC

T4R TAGTATGGCTAATCTTATTGG

Т4Р CY5 ACATTGGCACTGACCGAGTTC.

Использование для разных видов контроля различные формы материала бактериофага Т4: суспензии и фрагмента генома со специфическими к нему праймерами и зондом обусловлено тем, что это позволяет контролировать корректное прохождение реакции в каждой пробирки, а также контролируется этап выделения ДНК из образцов.

При конструировании праймеров и зонда основными требованиями были: степень гомологии (комплементарность) с выбранным участком гена; отсутствие самокоплементарных участков внутри олигонуклеотидов и комплементарности друг другу, чтобы не допускать возникновения устойчивых вторичных структур (димеров); близость значений температуры отжига праймеров.

Конструирование специфических праймеров и зонда осуществляли с помощью компьютерных программ на основании анализа нуклеотидных последовательностей референтных штаммов и изолятов, опубликованных на ресурсе GenBank и подбора условий для проведения ПЦР в реальном времени с применением разработанных праймеров и зонда, несущего флуорофор и тушитель, и комплементарного части амплифицируемого со специфическими праймерами фрагмента.

Праймеры, специфичные для барана (Ovis aries) и быка (говядины) (Bos taurus) были отобраны на основе митохондриальных последовательностей ДНК геномов барана и быка (Ovis aries isolate SH21 ATP synthase FO subunit 6 (ATP6) gene, partial cds; mitochondrial, код доступа KY453456.1 complete genome, участок между 122 и 353 и Bos taurus mitochondrion, complete genome 4724 и 4957). Праймеры спроектированы с использованием Primer Express Software v3.0 (Applied Biosystems) и исследованы с использованием BLAST, чтобы подтвердить их специфичность. Для детекции продуктов амплификации подобраны олигонуклеотидные флуоресцентно-меченные зонды Ovis Р (комплементарный участку нуклеотидной последовательности, ограниченной позициями отжига праймеров Ovis F и Ovis R) и Bos Р (комплементарный участку нуклеотидной последовательности, ограниченной позициями отжига праймеров Bos F и Bos R). Зонды были помечены красителями FAM и HEX. Используя программу "Oligo 6.0 м описаны основные свойства рассчитанных олигонуклеотидов, определившие возможность их использования в ПЦР. Ни одна из выбранных последовательностей не обнаружена в геноме любых видов растений и животных, которые потенциально встречаются вблизи тех, которые определены в кормах и пищевых продуктах.

В качестве внутреннего контроля использовался бактериофаг Т4, имеющий геномную ДНК порядка 169-170 тысяч пар нуклеотидов (Enterobacteria phage Т4Т, complete genome GenBank: HM137666.1). В результате анализа был выбран участок между 400 и 500 нуклеотидами, содержащий уникальные нуклеотидные последовательности, рассчитаны первичные структуры олигонуклеотидных праймеров, фланкирующих выбранный участок генома. Праймеры были спроектированы с использованием Primer Express Software v3.0 (Applied Biosystems) и исследованы с использованием BLAST, чтобы подтвердить их специфичность.

Для детекции продуктов амплификации подобран олигонуклеотидный флуоресцентно-меченный зонд Т4Р, комплементарный участку нуклеотидной последовательности, ограниченной позициями отжига праймеров T4F и T4R. Зонд был помечен красителем Су5. Используя программу "Oligo 6.0" описаны основные свойства рассчитанных олигонуклеотидов, определившие возможность их использования в ПЦР.

Пример

Для подтверждения эффективности тест-системы были использованы сухие корма в виде рыбной и мясной муки; сырые и термически обработанные мясные продукты, т.е. мясные полуфабрикаты.

От пробы плотной консистенции отбирают на исследование общую пробу весом 10-50 г. Гранулированную или консервированную продукцию перед исследованием (10-20 г) растирают в ступке до гомогенного состояния.

Лабораторные пробы (20-40 мг) отбирают на исследование в одноразовые микропробирки вместимостью 1,5 мл в двух повторах. Отобранные лабораторные пробы направляют на выделения ДНК.

Исследование проводили с помощью набора реагентов «ПЦР-БАРАНИНА-ГОВЯДИНА-ФАКТОР». Набор состоит из комплекта реагентов для проведения мультиплексной ПЦР (комплект №1) и комплекта контрольных образцов (комплект №2). Набор выпускается в двух вариантах: 1) Для анализа 55 образцов (включая контрольные образцы) 2) Для анализа 110 образцов (включая контрольные образцы). Наборы используют в соответствии с инструкцией по применению набора реагентов «ГЩР-БАРАНИНА-ГОВЯДИНА-ФАКТОР» для определения видовой принадлежности тканей жвачных животных видов Ovis aries (бараны) и Bos taurus (быки) методом полимеразной цепной реакции (ПЦР) с флуоресцентной детекцией в режиме реального времени ТУ21.10.60-152-51062356-2018, http://www.vetfaktor.ru/.

Состав набора приведен в Таблицах 1 и 2.

* Возможна легкая опалесценция

Исследования состоит из трех этапов:

- экстракция нуклеиновая кислота (НК);

- проведение реакции ПЦР РВ;

- учет результатов анализа.

Для экстракции (выделение) НК из исследуемых проб отбирают необходимое количество одноразовых пробирок объемом 1,5 мл, включая отрицательный контроль выделения. Во все пробирки с исследуемыми образцами, включая пробирку для отрицательный контрольный образец (ОКО), вносят по 10 мкл внутренний контрольный образец (ВКО) для баранины и говядины (БГ) в качестве которого используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл. Следующий этап это подготовка образцов к проведению ПЦР. Общий объем реакционной смеси - 25 мкл, объем ДНК-пробы - 10 мкл.

Успешное прохождение реакции контролируют использованием положительный контрольный образец (ПКО) БГ, ВКО БГ и ДНК буфера. В качестве ПКО используют смесь содержащую фрагменты геномов баранины (Ovis), говядины (Boss) и бактериофага Т4 взятых в соотношении 1:1:1.

В отдельной пробирке смешать компоненты набора из расчета на каждую реакцию:

5 мкл ПЦР СМЕСЬ БГ;

10 мкл ПЦР БУФЕР БГ;

0,5 мкл TAQ POLYMERASE

Перемешивают смесь на вортексе и сбросывают капли кратковременным центрифугированием.

Отбирают необходимое количество пробирок для амплификации ДНК исследуемых и контрольных проб. Вносят по 15 мкл приготовленной реакционной смеси.

Помещают подготовленные для проведения ПЦР пробирки в ячейки амплификатора и используют программное обеспечение прибора Далее проводят ПЦР РВ с флуоресцентной детекцией.

Параметры температурно-временного режима амплификации на приборе «Rotor-Gene Q» представлены в таблице 3.

Интерпретация результатов анализа.

Полученные данные - кривые накопления флуоресцентного сигнала анализируются с помощью программного обеспечения используемого прибора для проведения ПЦР в соответствии с инструкцией производителя к прибору. Учет результатов ПЦР РВ проводится по наличию или отсутствию пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией (что соответствует наличию или отсутствию значения порогового цикла «Ct» для исследуемого образца).

Результат считается достоверным в случае корректного прохождения положительных и отрицательных контролей амплификации и экстракции ДНК в соответствии с таблицей 4.

Появление любого значения Ct в таблице 4 результатов для отрицательного контроля этапа экстракции ВК- на каналах ROX/Orange и JOE/Yellow и для отрицательного контроля этапа ПЦР К- на любом из каналов свидетельствует о наличии контаминации реактивов или образцов (рис. 1,2). В этом случае результаты анализа для всех проб считаются недействительными. Требуется повторить анализ всех проб, а также предпринять меры по выявлению и ликвидации источника контаминации.

Образцы, для которых значение Ct по каналу Cy5/Red отсутствует или превышает 35 цикл (и при этом не получен положительный результат на каналах JOE/Yellow и/или ROX/Orange) требуют повторного проведения исследования с этапа экстракции ДНК. Задержка в значениях пороговых циклов для исследуемых образцов указывает на присутствие ингибиторов в пробе(ах) или на ошибки при экстракции ДНК или при постановке реакции ПЦР РВ.

В образце обнаружена ДНК Ovis aries баранины, если наблюдается экспоненциальный рост сигнала на канале JOE/Yellow, при этом значения Ct контрольных образцов находятся в пределах нормы (Табл. 4, рис. 3, 5).

В образце обнаружена ДНК Bos taurus говядины, если наблюдается экспоненциальный рост сигнала на канале Rox/Orange, при этом значения Ct контрольных образцов находятся в пределах нормы (Табл. 4, рис. 4, 5).

Если для исследуемого образца по каналам JOE/Yellow и/или ROX/Orange значение Ct определяется позднее 37 цикла при корректном прохождении положительных и отрицательных контролей, образец исследуется повторно с этапа экстракция ДНК. Если при повторной постановке Ct более 37 результат считается отрицательным (содержание целевой ДНК ниже предела обнаружения метода).

Образец считается отрицательным (ДНК Ovis aries и/или Bos taurus не обнаружена) если не определяется значение Ct (не наблюдается рост специфического сигнала) на канале Rox/Orange и/или JOE/Yellow при этом значения Ct контрольных образцов находятся в пределах нормы (Табл. 4, рис. 3, 4, 5), а значение Ct по каналу Cy5/Red менее 35.

Для исследуемых образцов (сухой корм и мясные полуфабрикаты) предел точности содержания баранины и говядины представлен в таблице 5.

Для доказательства эффективности использования ПЦР с флуоресцентной детекцией в режиме реального времени проводился сравнительный анализ чувствительности заявляемого с прототипом, в котором использовался метод ПЦР с электрофоретической детекцией. Оказалось чувствительность ПЦР с флуоресцентной детекцией при обнаружении примеси тканей баранины и говядины в кормах в 10 раз выше, чем ПЦР с электрофоретической детекцией.


Тест-система для идентификации видовой принадлежности баранины и говядины в продовольственном сырье, кормах и пищевых продуктах
Тест-система для идентификации видовой принадлежности баранины и говядины в продовольственном сырье, кормах и пищевых продуктах
Источник поступления информации: Роспатент

Всего документов: 351
Всего документов: 241

Похожие РИД в системе