15.03.2019
219.016.e174

Рекомбинантная плазмидная днк ppins16, кодирующая гибридный полипептид, содержащий проинсулин человека, рекомбинантная плазмидная днк ppins25, кодирующая гибридный полипептид, содержащий проинсулин человека, и штамм бактерий escherichia coli - продуцент гибридного полипептида, содержащего проинсулин человека

Вид РИД

Изобретение

Юридическая информация Свернуть Развернуть
Краткое описание РИД Свернуть Развернуть
Аннотация: Изобретение относится к биотехнологии, в частности к генетической инженерии. Может быть использовано для получения рекомбинатного проинсулина человека. Рекомбинантная плазмидная ДНК pPINS16 содержит искусственный ген, кодирующий гибридный полипептид, состоящий из одного IgG-связывающего домена белка А из S. aureus, пептидного линкера HisGlySerArg и проинсулина человека, тандем промоторов триптофанового оперона Е.соli и синтетический усилитель трансляции гена 10 бактериофага Т7. Рекомбинантная плазмидная ДНК pPINS16 обеспечивает в клетках E.coli SG20050 конститутивный биосинтез гибридного полипептида на уровне 25-30% суммарного клеточного белка. Рекомбинантная плазмидная ДНК pPINS25 содержит искусственный ген, кодирующий гибридный полипептид, состоящий из одного IgG-связывающего домена белка А из S. aureus, пептидного линкера HisGlySerArg и проинсулина человека, гибридный trc-промотор, тандем двух терминаторов рибосомного оперона E.coli и мутантный ген, кодирующий термочувствительный lac-репрессор. Штамм Escherichia coli SG20050/pPINS25-продуцент гибридного полипептида, содержащего проинсулин человека. Изобретение позволяет индуцировать биосинтез целевого гибридного полипептида сдвигом температуры культивирования штамма-продуцента с 30 до 42°С. Уровень биосинтеза составляет не ниже 25% суммарного клеточного белка. 3 с.п.ф-лы, 3 ил.
Реферат Свернуть Развернуть

Изобретение относится к области генетической инженерии и медицины и может быть использовано для создания лекарственных препаратов для лечения инсулинзависимого сахарного диабета.

Инсулин - пептидный гормон поджелудочной железы - синтезируется специализированными клетками, называемыми островками Лангерганса, в виде предшественника - препроинсулина, состоящего из 109 аминокислотных остатков. В процессе биосинтеза в результате отщепления сигнального пептида из 23 аминокислот высвобождается проинсулин. В дальнейшем проинсулин подвергается дальнейшему процессингу, приводящему к образованию собственно инсулина в результате специфического "выщепления" 35 аминокислот C-пептида. Зрелый биологически активный инсулин состоит из двух цепей, соединенных двумя дисульфидными связями. Цепь A содержит 21, а цепь B - 30 аминокислотных остатков.

Производство рекомбинантного инсулина человека основано на использовании гена проинсулина человека, полученного либо синтезом кДНК на матрице мРНК, выделенной из поджелудочной железы человека [1, 2], либо химико-ферментативным синтезом [3, 4]. При этом широко используется методология экспрессии гена проинсулина человека в клетках E.coli в составе гибридных белков в виде нерастворимых "телец включения". В качестве лидерных последовательностей, защищающих рекомбинантный белок от протеолитической деградации, использовали гомоолигопептиды [5] , бычий протимозин [6], глутатион-S-трансферазу [7], C-пептид проинсулина [8] и др. Отщепление инсулина от лидерного пептида достигается обработкой бромцианом по остатку метионина [9, 10].

Однако перечисленные полипептидные конструкции в настоящее время не используются вследствие низкой технологичности и необходимости использования высокотоксичного реагента на стадии расщепления белка-предшественника.

Наиболее близким по технической сущности к предлагаемому изобретению является рекомбинантная плазмидная ДНК pTrpZZ-R-proinsulin [11], кодирующая гибридный белок массой около 27 кДа, в котором тандем двух IgG-связывающих доменов соединен через остаток аргинина с аминокислотной последовательностью проинсулина человека. Биосинтез гибридного полипептида в клетках штамма-продуцента контролируется индуцибельным tac-промотором.

Однако необходимость индукции биосинтеза гибридного белка изопропилтио-β, D-галактопиранозидом (IPTG) усложняет технологический процесс и в значительной степени повышает затраты на получение целевого продукта - инсулина человека. Существенным недостатком является также невозможность промышленного масштабирования процесса получения инсулина человека из-за использования IgG-сефарозы для очистки гибридного полипептида перед ренатурацией.

Задачей изобретения является конструирование рекомбинантных плазмид и штамма-продуцента гибридного полипептида, содержащего проинсулин человека, обеспечивающих конститутивный и термоиндуцибельный биосинтез гибридного полипептида с уровнем экспрессии 25-30% суммарного клеточного белка и позволяющих упростить технологический процесс получения целевого продукта - инсулина человека - при их использовании.

Поставленная задача решается конструированием рекомбинантной плазмидной ДНК pPINS16, а также рекомбинантной плазмидной ДНК pPINS25 и штамма Escherichia coli SG20050/pPINS25.

Рекомбинантная плазмидная ДНК pPINS16 с молекулярной массой 2,82 МДа кодирует гибридный полипептид, содержащий проинсулин человека, в котором последовательность домена B стафилококкового белка A соединена через пептидный линкер His6GlySerArg с аминокислотной последовательностью проинсулина человека; она состоит из ClaI/HindIII-фрагмента плазмиды pGGF8, включающего тандем двух trp-промоторов, ген β-лактамазы (bla), определяющий устойчивость трансформированных плазмидой pPINS16 клеток бактерий к ампициллину, участок инициации репликации (ori), терминатор транскрипции бактериофага λ и ClaI/HindIII-фрагмента, содержащего искусственный ген, кодирующий IgG-связывающий домен белка A из S. aureus с гексагистидиновым доменом, соединенным через трипептид GlySerArg с последовательностью проинсулина человека.

Рекомбинантная плазмидная ДНК pPINS25 с молекулярной массой 3,12 МДа кодирует гибридный полипептид, содержащий проинсулин человека, в котором последовательность домена B стафилококкового белка A соединена через пептидный линкер His6GlySerArg с аминокислотной последовательностью проинсулина человека, она состоит из ClaI/HindIII-фрагмента плазмиды pTrcTEGFa, включающего химерный trc-промотор, синтетический усилитель трансляции гена X бактериофага T7, ген β-лактамазы (bla), определяющий устойчивость трансформированных плазмидой pPINS25 клеток бактерий к ампициллину, участок инициации репликации (ori), терминатор транскрипции рибосомного оперона E. coli, Iq-вариант гена lac-репрессора с ts-мутацией Gly187Ser и ClaI/HindIII-фрагмента плазмиды pPINS16, содержащего искусственный ген, кодирующий IgG-связывающий домен белка A из S. aureus с гексагистидиновым линкером, соединенным через трипептид GlySerArg с последовательностью проинсулина человека.

Штамм бактерий Escherichia coli SG20050/pPINS25 - продуцент гибридного полипептида, содержащего проинсулин человека.

Использование изобретения позволяет получить следующий технический результат.

Рекомбинантная плазмидная ДНК pPINS16 позволяет упростить и удешевить технологию культивирования рекомбинантного бактериального штамма, в частности, E. coli SG20050, обеспечивая в его клетках биосинтез гибридного полипептида на уровне 25-30% суммарного клеточного белка за счет содержащегося в ней гибридного гена, который экспрессируется конститутивно и не требует стадии химической индукции.

Использование рекомбинантной плазмидной ДНК pPINS25 позволяет избежать длительного культивирования штамма-продуцента E. coli SG20050 и повысить за счет этого качество гибридного полипептида в "тельцах включения", а также обеспечивает высокий уровень его биосинтеза - 25-30% суммарного клеточного белка, который индуцируется сдвигом температуры культивирования от 30oC до 42oC. Температурная индукция транскрипции целевого гена в плазмидной ДНК pPINS25 обеспечивается гибридным промотором Ptrc и наличием гена, кодирующего термочувствительный lac-репрессор.

Исходной для конструирования плазмидной ДНК pPINS16 служила ДНК pGGF8, кодирующая конститутивный биосинтез гранулоцитарного колониестимулирующего фактора человека под контролем тандема двух промоторов триптофанового оперона E. coli [12]. Конструирование плазмидной ДНК pPINS16 было проведено с помощью полимеразной цепной реакции. В качестве источника гена, кодирующего гибридный полипептид с проинсулином человека, использовали плазмидную ДНК pPINS07, сконструированную на основе плазмидного вектора pKK223-3. Рекомбинантная плазмидная ДНК pPINS07 содержит искусственный ген, кодирующий полипептид, состоящий из одного IgG-связывающего домена белка A из S. aureus, пептидного линкера His6GlySerArg и проинсулина человека, гибридный tac-промотор и терминатор транскрипции рибосомного оперона E. coli.

С использованием ДНК плазмиды pPINS07 в качестве матрицы аплифицировали ген, кодирующий гибридный белок, с праймерами

и
TCTCTCATCCGCCAAAA (II).

В структуре праймера I подчеркиванием выделен сайт рестриктазы ClaI. Продукт амплификации обрабатывали рестрикционными эндонуклеазами ClaI и HindIII, и гидролизат после очистки электрофорезом в 1% геле легкоплавкой агарозы лигировали с вектором, полученным гидролизом плазмиды pGGF8 рестриктазами ClaI и HindIII. В результате получили плазмидную ДНК pPINS16, кодирующую гибридный полипептид, содержащий проинсулин человека. Плазмида pPINS16 детерминирует в клетках E. coli SG20050 конститутивный биосинтез гибридного белка, содержание которого составляет 25-30% суммарного клеточного белка.

Рекомбинантная плазмидная ДНК pPINS16 кодирует гибридный полипептид с аминокислотной последовательностью проинсулина человека и характеризуется следующими признаками:
имеет молекулярную массу 2,82 МДа (4,274 т.п.о.);
кодирует гибридный белок, в котором последовательность IgG-связывающего домена B стафолококкового белка A с C-концевым гексагистидиновым линкером соединена через трипептид GlySerArg с аминокислотной последовательностью проинсулина человека;
состоит из: ClaI/HindIII-фрагмента плазмиды pGGF8, содержащей тандем двух trp-промоторов, ген β-лактамазы (bla), участок инициации репликации (ori), терминатор транскрипции бактериофага λ [13] и полученного амплификацией ClaI/HindIII-фрагмента, включающего искусственный ген, кодирующий IgG-связывающий домен белка A из S. aureus с гексагистидиновым доменом, соединенным через трипептид GlySerArg с последовательностью проинсулина человека;
содержит: тандем двух trp-промоторов транскрипции, синтетический усилитель трансляции гена X бактериофага T7, искусственный ген, кодирующий гибридный полипептид, в котором последовательность домена B стафилококкового белка A с C-концевым гексагистидиновым линкером соединена через трипептид GlySerArg с аминокислотной последовательностью проинсулина человека; терминатор транскрипции бактериофага λ, в качестве генетического маркера ген β-лактамазы (bla), определяющий устойчивость трансформированных плазмидой pPINS16 клеток бактерий к ампициллину; уникальные сайты узнавания рестрикционными эндонуклеазами, имеющими следующие координаты:
EcoRI - 278, ClaI - 384, KpnI - 290, NcoI - 599 и 1677, BamHI - 603 и 1045, HindIII - 874.

Преимуществом предложенной плазмидной конструкции является то, что содержащийся в ней гибридный ген экспрессируется конститутивно, что не требует стадии химической индукции и значительно удешевляет и упрощает технологию культивирования рекомбинантного бактериального штамма B то же время необходимость длительного культивирования штамма-продуцента на основе плазмиды pPINS16 в значительной степени снижает качество гибридного полипептида в "тельцах включения".

Отмеченный недостаток устраняют конструированием рекомбинантной плазмидной ДНК, детерминирующей термоиндуцибельную экспрессию искусственного гена, кодирующего гибридный полипептид, состоящий из одного IgG-связывающего домена B белка A из S. aureus, пептидного линкера His6GlySerArg и проинсулина человека.

Конструируют рекомбинантную плазмидную ДНК pPINS25, в которой экспрессия гибридного гена, кодирующего биотехнологический предшественник инсулина человека, контролируется сдвигом температуры культивирования плазмидосодержащего штамма. Температурная индукция целевого гена в плазмиде pPINS25 обеспечивается гибридным промотором Ptrc и наличием гена, кодирующего термочувствительный lac-репрессор.

Для конструирования плазмиды pPINS25 на первом этапе провели клонирование ClaI/HindIII-фрагмента плазмиды pPINS16, содержащего искусственный ген, кодирующий гибридный белок с последовательностью проинсулина человека, в плазмиду pTrcTEGFa [14]. В результате получили плазмиду pTrcPINS, в которой экспрессия целевого гибридного гена находится под контролем химерного trc-промотора и синтетического участка инициации трансляции с энхансером. Наличие в этой плазмиде Iq-аллельного варианта гена репрессора позволяет использовать эту плазмиду для индуцибельной экспрессии гибридного гена в любом штамме кишечной палочки. При этом экспрессия может иметь место только при индукции IPTG. Для получения термоиндуцибельного варианта проводили сайт направленный мутагенез. В качестве мишени для мутации был выбран остаток Gly187, так как замена его на серин приводит к фенотипу ts гена lac-репрессора [15, 16]. Мутагенез проводили на матрице плазмидной ДНК pTrcPINS с помощью двухстадийной полимеразной цепной реакции, при этом использовали уникальные для этой плазмиды сайты рестриктаз BstEl и EcoRI. Для мутагенеза были синтезированы два мутагенизирующих праймера:

и

(подчеркнуты измененные триплеты) и два якорных праймера: ACACCCATCAACAGTATTAT (V) и TACCGAGCTCGAATTCCAT (VI).

Чтобы реализовать аминокислотную замену Gly187Ser на первом этапе проводили реакцию на матрице плазмиды pTrcPINS с мутагенизирующим праймером (III) и якорным праймером (VI). Параллельно проводили полимеразную цепную реакцию (ПЦР) с праймерами (IV) и (V). Продукты ПЦР величиной 850 и 120 пар оснований (п. о. ) отделяли от праймеров, отжигали и проводили новый цикл ПЦР в присутствии только якорных праймеров (V) и (VI). Полученный таким образом фрагмент величиной 950 п.о. гидролизовали рестриктазами BstEl и EcoRI, и образовавшийся фрагмент клонировали по тем же сайтам в плазмиду pTrcPINS. В результате получили плазмиду pPINS25, содержащую мутантный ген lac-репрессора и искусственный ген, кодирующий гибридный белок с проинсулином человека под контролем trc-промотора.

Рекомбинантная плазмидная ДНК pPINS25 кодирует гибридный полипептид с аминокислотной последовательностью проинсулина человека и характеризуется следующими признаками:
имеет молекулярную массу 3,12 МДа (4,721 т.п.о.);
кодирует гибридный белок, в котором последовательность IgG-связывающего домена B стафолококкового белка A с C-концевым гексагистидиновым линкером соединена через трипептид GlySerArg с аминокислотной последовательностью проинсулина человека;
состоит из: ClaI/HindIII-фрагмента плазмиды pTrcTEGFa, содержащего trc-промотор, ген β-лактамазы (bla), участок инициации репликации (ori), терминатор транскрипции рибосомного оперона E. coli [17], Iq-вариант гена lac-репрессора с ts-мутацией Gly187Ser и ClaI/HindIII-фрагмента плазмиды pPINS16, содержащего искусственный ген, кодирующий IgG-связывающий домен белка A из S. aureus с гексагистидиновым линкером, соединенным через трипептид GlySerArg с последовательностью проинсулина человека;
содержит: химерный trc-промотор транскрипции, синтетический усилитель трансляции гена X бактериофага T7, искусственный ген, кодирующий гибридный полипептид, в котором последовательность домена B стафилококкового белка A с C-концевым гексагистидиновым линкером соединена через трипептид GlySerArg с аминокислотной последовательностью проинсулина человека; терминатор транскрипции рибосомного оперона E. coli, Iq-вариант гена lac-репрессора с ts-мутацией Gly187Ser; в качестве генетического маркера ген β-лактамазы (bla), определяющий устойчивость трансформированных плазмидой pPINS25 клеток бактерий к ампициллину; уникальные сайты узнавания рестрикционными эндонуклеазами, имеющими следующие координаты:
EcoRI - 270, KpnI - 282, XbaI - 340, ClaI - 376, NcoI - 265 и 591, BamHI - 595, PstI - 712 и 787, HindIII - 866, BstEI - 4131, EcoRV - 4398.

Для получения штамма-продуцента гибридного полипептида с проинсулином человека трансформируют компетентные клетки Escherichia coli SG20050 рекомбинантной плазмидной ДНК pPINS25.

Полученный штамм Escherichia coli SG20050/pPINS25 характеризуется следующими признаками.

Морфологические признаки. Клетки мелкие укороченной палочковидной формы, грамотрицательные, неспороносные, 1 х 3,5 мкм, подвижные.

Культуральные признаки. При росте на агаризованной среде LB колонии круглые, гладкие, полупрозрачные, блестящие, серые. Край ровный, диаметр колоний 1-3 мм, консистенция пастообразная. Рост в жидких средах (LB, минимальная среда с глюкозой) характеризуется ровным помутнением, осадок легко седиментирует.

Физико-биохимические признаки. Клетки растут при температуре 4 - 42oC, оптимум pH 6,8-7,6. В качестве источника азота используют как минеральные соли аммония, так и органические соединения: аминокислоты, пептон, триптон, дрожжевой экстракт. В качестве источника углерода при росте на минимальной среде используют глицерин, углеводы, аминокислоты.

Устойчивость к антибиотикам. Клетки штамма-продуцента проявляют устойчивость к ампициллину (до 300 мг/мл), обусловленную наличием в плазмиде гена β-лактамазы (bla).

Полученный штамм депонирован в коллекции микроорганизмов ИБХ РАН под номером 113.

На фиг. 1 представлена нуклеотидная последовательность и кодируемая ею аминокислотная последовательность ClaI/HindIII-фрагмента плазмиды pPINS25; на фиг. 2 - физическая карта плазмиды pPINS16, на фиг. 3 - физическая карта плазмиды pPINS25.

Изобретение иллюстрируется следующими примерами.

Пример 1. Конструирование рекомбинантной плазмидной ДНК pPINS16.

5 мкг плазмидной ДНК pGGF8 обрабатывают совместно рестриктазами ClaI (10 ед) и HindIII (15 ед) в буфере R, содержащем 50 мМ Трис-HCl, pH 7,5, 10 мМ MgCl2, 50 мМ NaCl и 10 мМ меркаптоэтанол, и из полученного гидролизата выделяют с помощью электрофореза в 1% агарозном геле векторную часть плазмиды (около 3,7 т.п.о.).

Для конструирования плазмиды с конститутивной экспрессией гена, кодирующего гибридный полипептид с последовательностью проинсулина человека, проводят полимеразную цепную реакцию на матрице 10 нг ДНК плазмиды pPINS07 в присутствии олигонуклеотидных праймеров (I) и (II) в 100 мкл буфера для амплификации A, содержащего 10 мМ Трис-HCl, pH 8,8, 50 мМ KCl, 0,1% Тритон X-100, 0,01% желатин, 1,25 мМ MgCl2, 0,1 мМ каждого дезоксинуклеозид-5'-трифосфата и 50 пмолей каждого из праймеров (I) и (II). Проводят 25 циклов амплификации (95oC, 60 с; 52oC, 45 с; 72oC, 45 с), продукт амплификации гидролизуют рестриктазами ClaI и HindIII и фрагмент величиной около 350 п.о., кодирующий гибридный полипептид, очищают электрофорезом в 6% ПААГ.

1 мкг полученного вектора лигируют 10 ч при 8oC с 0,1 мкг полученного амплификацией ClaI/HindIII-фрагмента, содержащего гибридный ген, кодирующий предшественник проинсулина человека, в 25 мкл буфера L, содержащего 50 мМ Трис-HCl, pH 7,5, 10 мМ MgCl2, 5 мМ дитиотреита и 0,1 мМ АТР, в присутствии 10 ед T4 ДНК-лигазы. 2 мкл лигазной смеси используют для трансформации компентентных клеток E. coil SG20050 [18]. Трансформанты высевают на LB-агар, содержащий 100 мкг/мл ампициллина. Из выросших клонов выделяют плазмидную ДНК pPINSl6 и анализируют рестриктным анализом при помощи эндонуклеаз HaeIII и HpaII, а также совместным гидролизом рестриктазами ClaI+HindIII. Окончательно строение плазмиды pPINSl6 подтверждали определением нуклеотидной последовательности между сайтами рестриктаз ClaI и HindIII методом твердофазной химической модификации [19].

Пример 2. Конструирование рекомбинантной плазмидной ДНК pPINS25.

3 мкг плазмидной ДНК pTrcTEGFa обрабатывают совместно рестриктазами ClaI и HindIII, как описано в предыдущем примере, и из полученного гидролизата выделяют с помощью электрофореза в 1% агарозном геле векторный фрагмент (около 4,3 т.п.о.).

Для клонирования гена, кодирующего гибридный полипептид с последовательностью проинсулина человека, проводят гидролиз 20 мкг плазмидной ДНК pPINSl6 в буфере R рестриктазами ClaI и HindIII и фрагмент величиной около 350 п.о., кодирующий гибридный полипептид очищают электрофорезом в 6% ПААГ.

1 мкг полученного вектора лигируют 10 ч при 8oC с 0,1 мкг ClaI/HindIII-фрагмента плазмиды pPINS16, содержащего гибридный ген, кодирующий предшественник проинсулина человека, в 25 мкл буфера L в присутствии 10 ед T4 ДНК-лигазы. 1 мкл лигазной смеси используют для трансформации компентентных клеток E. coli SG20050 [18]. Трансформанты высевают на LB-агар, содержащий 100 мкг/мл ампициллина. Из выросших клонов выделяют плазмидную ДНК pTrcPINS и анализируют рестриктным анализом при помощи эндонуклеаз HaeIII и HpaII, а также совместным гидролизом рестриктазами ClaI+HindIII. Окончательно строение плазмиды pTrcPINS подтверждали определением нуклеотидной последовательности между сайтами рестриктаз ClaI и HindIII.

Замену глицинового кодона на сериновый в гене lac-репрессора проводят при помощи двухступенчатой полимеразной цепной реакции на матрице плазмиды pTrcPINS. Для этого на первом этапе 0,01 мкг ДНК плазмиды pTrcPINS амплифицируют в 50 мкл буфера, содержащего 25 мМ Трис-HCl, pH 8,8, 10 мМ (NH4)2SO4, 1,2 мМ MgCl2, 2 мМ меркаптоэтанол, 0,1 мМ каждого дезоксинуклеозид-5'-трифосфата и 50 пмолей мутагенизируещего (III) и якорного (VI) праймеров, в присутствии 2,5 ед Taq-ДНК-полимеразы. Проводят 20 циклов амплификации (94oC, 30 с; 48oC, 45 с; 72oC, 45 с). Продукт амплификации очищают электрофорезом в 1% геле легкоплавкой агарозы. В параллельном эксперименте проводят амплификацию на матрице ДНК плазмиды pTrcPINS с мутагенизирующим праймером (IV) и якорным праймером (V). Продукт величиной около 120 п.о. очищают при помощи электрофореза в 6% полиакриламидном геле. После этого смешивают 0,05 мкг каждого продукта амплификации и проводят еще 25 циклов амплификации, как описано выше, в присутствии только якорных праймеров (V) и (VI). Продукт амплификации величиной около 950 п.о. гидролизуют рестриктазами BstEl и EcoRI и лигируют с вектором, полученным гидролизом плазмидной ДНК pTrcPINS теми же рестриктазами в буфере L. 2 мкл лигазной смеси используют для трансформации компетентных клеток E. coli SG20050 [18]. Трансформанты высевают на LB-агар, содержащий 100 мкг/мл ампициллина. Из выросших клонов выделяют плазмидную ДНК и анализируют гидролизом рестриктазами HaeIII и HpaII и окончательно строение плазмиды pPINS25 подтверждают определением нуклеотидной последовательности фрагмента ДНК между сайтами рестриктаз BstEI и EcoRI. Полученная таким образом плазмида pPINS25 содержит ген, кодирующий гибридный полипептид, содержащий проинсулин человека под контролем trc-промотора, причем экспрессия этого гена индуцируется сдвигом температуры культивирования с 30oC до 42oC благодаря наличию в плазмиде гена термочувствительного lac-репрессора.

Пример 3. Определение продуктивности штамма E. coli SG20050/pPINS25 - продуцента гибридного полипептида, содержащего проинсулин человека.

В 20 мл жидкой среды LB, содержащей 100 мкг/мл ампициллина, инокулируют индивидуальную колонию клеток E. coli SG20050, содержащих плазмиду pPINS25 и выращивают при 30oC на качалке при 180 об/мин в течение 6 ч до мутности 0,8. Затем пробирку переносят в термостат, подогретый до 42oC, и продолжают инкубацию в течение 30 мин, после чего продолжают выращивание на качалке при 180 об/мин в течение 6 ч при 37oC. Отбирают пробу 2 мл и центрифугируют 5 мин при скорости 6000 об/мин, после чего клетки суспендируют в 200 мкл буфера, содержащего 125 мМ Трис-HCl, pH 6,8, 20% глицерин, 3% додецилсульфат натрия, 3% меркаптоэтанол и 0,01% бромфеноловый синий, и нагревают 10 мин на кипящей водяной бане. Отбирают образцы 2,5 мкл, 5 мкл, 7,5 мкл, 10 мкл и 15 мкл и анализируют электрофорезом в 13% полиакриламидном геле, содержащем 0,1% додецилсульфат натрия [20]. Гель окрашивают Кумасси R-250 и сканируют на лазерном денситометре Ultrascan XL. По данным сканирования гибридный полипептид составляет 25 - 30% суммарного клеточного белка.

Источники информации
1. Bell G. 1., Swain W. F., Pictet R., Cordell B., Goodman H. M., Rutter W. J. // Nature, 1979, v. 282, p. 525 - 527.

2. Sures I., Goeddel D. V., Gray A., Ulrich A. // Science, 1980, v. 208, p. 57 - 59.

3. Williams D. С., Van Frank R. M., Murth M. L., Burnett J. P. // Science, 1982, v. 215, p. 687 - 689.

4. Ovchinnikov Y. A. , Efimov V. A., Ivanova I. N., Reverdatto S. V., Skiba N. P., Chakhmakhcheva O. G. // Gene, 1984, v. 31, p. 65 - 68.

5. Sung W. L., Yao F.L., Zanab D. M., Narang S. A. // Proc. Natl. Acad. Sci. USA, 1986, v. 83, p. 561 - 565.

6. Tang J., Xue Y., Fan X., Fu Y. // Clin J. Biotechnol., 1993, v. 9, p. 71 - 78.

7. Berg H. , Walter M., Mauch L., Seissler J., Northemann W. J. // Immunol. Methods, 1993, v. 164, p. 221 - 231.

8. Wei G. , Hu M. H., Tang L. G. // Biochem. Mol. Biol. Int., 1995, v. 35, p. 37 - 46.

9. McGregor W. С. // Ann. N. Y. Acad. Sci., 1983, v. 413, p. 231 - 237.

10. Cowley D. J., Mackin R.B. // FEBS Lett., 1997, v. 402, p. 124 - 130.

11. Johansson P., Nilsson L., Samuelsson E., Moks T., Stahl S., Uhlen M. // Eur. J. Biochem., 1996, v. 236, p. 656 - 661.

12. Патент РФ N 96113021/13. Бюлл. N 13, 20.06.98.

13. Rosenberg M., Court D., Shimatake H., Brady C., Wulff D. // The operon / Eds. Miller J.H., Reznikoff W.S. Cold Spring Harbor Laboratory. 1980. P. 345 - 371.

14. Шингарова Л. Н., Кашьяп С.К., Петровская Л.Е., Петренко Л.А., Пустошилова Н.М., Синичкина С.А., Коробко В.Г. // Биотехнология, 1998, N 6, с. 24 - 35.

15. Bukrinsky MI, Barsov EV, Shilov AA // Gene, 1988, v. 70, p. 415 - 417.

16. Yabuta M., Onai-Miura S., Ohsuye K. // J. Biotechnol, 1995, v. 39, p. 67 - 73.

17. Brosius J., Dull T. J., Sleeter D. D., Noller H. F. // J. Mol. Biol. , 1981, v. 148, p. 107 - 127.

18. Hanahan J. // J. Mol. Biol., 1983, v. 227, p. 557 - 580.

19. Чувпило С. А, Кравченко В. В. // Биоорган, химия, 1983, т. 9, с. 1634 - 1637.

20. Laemmli U.K. // Nature, 1970, v. 227, p. 680 - 687.

1.РекомбинантнаяплазмиднаяДНКPINS16,кодирующаягибридныйполипептид,содержащийпроинсулинчеловека,вкоторомпоследовательностьдоменаВстафилококковогобелкаАсоединеначерезпептидныйлинкерHisGlySerArgсаминокислотнойпоследовательностьюпроинсулиначеловека,смолекулярноймассой2,82МДа,состоящаяизClaI/HindIII-фрагментаплазмидыpGGF8,включающеготандемдвухtrp-промоторов,генβ-лактамазы(bla),участокинициациирепликации(ori),терминатортранскрипциибактериофагаλиClaI/HindIII-фрагмента,содержащегоискусственныйген,кодирующийIgG-связывающийдоменбелкаАиS.aureuscгексагистидиновымлинкером,соединеннымчерезтрипептидGlySerArgспоследовательностьюпроинсулиначеловека,вкачествегенетическогомаркерагенβ-лактамазы(bla),определяющийустойчивостьтрансформированныхплазмидойpPINS16клетокбактерийкампициллину,уникальныесайтыузнаваниярестрикционнымиэндонуклеазами,имеющимиследующиекоординаты:EcoRI-278,ClaI-384,KpnI-290,NcoI-599и1677,BamHI-603и1045,HindIII-874.12.РекомбинантнаяплазмиднаяДНКpPINS25,кодирующаягибридныйполипептид,содержащийпроинсулинчеловека,вкоторомпоследовательностьдоменаВстафилококковогобелкаАсоединеначерезпептидныйлинкерHisGlySerArgсаминокислотнойпоследовательностьюпроинсулиначеловека,смолекулярноймассой3,12МДа,состоящаяизClaI/HindIII-фрагментаплазмидыpTrcTEGFa,включающегохимерныйtrc-промотор,синтетическийусилительтрансляциигенаХбактериофагаТ7,генβ-лактамазы(bla),участокинициациирепликации(ori),терминатортранскрипциирибосомногооперонаЕ.coli,I-вариантгенаlac-репрессорасt-мутациейGlySerиClaI/HindIII-фрагментаплазмидыpPINS16,содержащегоискусственныйген,кодирующийIgG-связывающийдоменбелкаАизS.aureusсгексагистидиновымлинкером,соединеннымчерезтрипептидGlySerArgспоследовательностьюпроинсулиначеловека,вкачествегенетическогомаркерагенβ-лактамазы(bla),определяющийустойчивостьтрансформированныхплазмидойpPINS25клетокбактерийкампициллину,уникальныесайтыузнаваниярестрикционнымиэндонуклеазами,имеющимиследующиекоординаты:EcoRI-270,KpnI-282,XbaI-340,ClaI-376,NcoI-265и591,BamHI-595,PstI-712и787,HindIII-866,BstEI-4131,EcoRV-4398.23.ШтаммбактерийEscherichiacoliSG20050/pPINS25-продуцентгибридногополипептида,содержащегопроинсулинчеловека.3
Источник поступления информации: Роспатент

Всего документов: 3

Похожие РИД в системе

Защитите авторские права с едрид