13.01.2017
217.015.653e

СПОСОБ РАННЕГО ПРОГНОЗИРОВАНИЯ НЕВЫНАШИВАНИЯ БЕРЕМЕННОСТИ

Вид РИД

Изобретение

Юридическая информация Свернуть Развернуть
Краткое описание РИД Свернуть Развернуть
Аннотация: Изобретение относится к области медицинской диагностики и может быть использовано для раннего прогнозирования невынашивания беременности. Способ включает выделение РНК из эпителиальных клеток цервикального канала у женщин, проведение обратной транскрипции с получением мДНК, определение экспрессии CASP-3α (отн. ед.) и COX-2 с помощью количественной полимеразной цепной реакции и расчет у и у по уравнениям линейной дискриминантной функции следующего вида: у=-0,8383+155,755*x+27,2986*x, у=-207,714+3007,030*x+533,609*x, где x - уровень экспрессии мРНК CASP-3α (отн. ед.), x - уровень экспрессии мРНК COX-2 (отн. ед.). Прогнозируют развитие невынашивания беременности ранних сроков, если y больше y. Прогнозируют прогрессирование беременности в случае, если y больше, чем y. Предложенное изобретение позволяет эффективно прогнозировать невынашивание беременности в 92,10% случаев. Применение данного способа позволит своевременно реализовывать необходимые лечебно-профилактические мероприятия по предупреждению невынашивания беременности. 3 табл.
Реферат Свернуть Развернуть

Изобретение относится к области медицинской диагностики, может быть использовано для раннего прогнозирования невынашивания беременности.

Невынашивание беременности ранних сроков представляет собой актуальную проблему современного акушерства, так как является полиэтиологическим состоянием, объединяющим различные нарушения как в репродуктивной системе, так и в организме женщины в целом (Тетруашвили Н.К., Агаджанова А.А. Программа обследования и предгестационой подготовки пациенток с привычным выкидышем (клиническая лекция)//Акуш. и гин. - 2012. - №6. - С. 87-91). Самопроизвольные выкидыши на ранних сроках встречаются в 15% среди всех зарегистрированных случаев беременности. При этом до 80% репродуктивных потерь приходится на I триместр (Carp H.J.A. Recurrent pregnancy loss: causes, controversies and treatment//Informa, 2007. - 290 p.). На самом деле число женщин с невынашиванием может быть несколько выше, так как часть самопроизвольных выкидышей происходит еще до обращения женщины к гинекологу в связи с фактом беременности (Радзинский В.Е., Димитрова В.И., Майскова И.Ю. Неразвивающаяся беременность//М.: Гэотар-медиа, 2009. - 208 с.). Около 1-2% женщин страдают привычным невынашиванием беременности. Привычный выкидыш может быть связан с наличием хромосомных аномалий, тромбофилических состояний у матери, а также с иммунными и эндокринными нарушениями, однако в 50% случаев причина выкидыша оказывается неустановленной (Ortel T.L. Antiphosphlipid syndrome: laboratory testing and diagnostic strategies//Am.J.Hematol. - 2012. - Vol.87, Suppl. 1. - P. 75-81). Поэтому изучение причин невынашивания беременности до сих пор является одной из актуальных проблем в акушерстве и гинекологии.

Среди причин невынашивания беременности одно из лидирующих мест занимают воспалительные заболевания (Kitaya K., Yasuo T. Immunohistochemistrical and Clinicopathological Characterization of Chronic Endometritis//American Journal of Reproductive Immunology. - 2008. - Vol.66, Iss. 5. - P. 410-415). Доказательством роли хронического эндометрита в генезе самопроизвольных выкидышей раннего срока является тот факт, что женщины с хроническим эндометритом имеют достоверно более низкую частоту имплантации эмбриона по сравнению с пациентками с нормальным эндометрием (11% и 58% соответственно) (Ковалева Ю.В. Роль патологии эндометрия в структуре причин невынашивания беременности//Бюллетень ФЦСКЭ им. В.А. Алмазова. - 2010. - №6. - С.35).

Однако диагностика хронического эндометрита в настоящее время представляет собой значительные трудности. В настоящее время для этого используется комплекс клинико-анамнестических данных, а также данных биопсии эндометрия, полученных при аспирационной биопсии или диагностическом выскабливании слизистой полости матки под контролем гистероскопии. При этом диагностическая ценность гистологического исследования для диагностики хронического эндометрита и прогноза невынашивания беременности не установлена (Kasius J.C., Broekmans F.J., Sie-Go D.M., Bourgain C. et al. The reliability of the histological diagnosis of endometritis in asymptomatic IVF cases: a multicenter observer study//Hum Reprod. - 2012. - Vol.27(1). - P. 153). В большинстве случаев при выявлении хронического эндометрита, являющегося причиной невынашивания, специфический возбудитель выявить не удается, что свидетельствует о неспецифическом характере воспаления в связи с изменениями местной иммунореактивности (Cakmak H., Taylor H.S. Implantation failure: molecular and clinical treatment//Hum. Reprod. Update. - 2011. - Vol.17(2). - P. 242-253).

Рассматривая плодово-материнские взаимодействия с точки зрения иммунного ответа, следует подчеркнуть, что взаимодействие матери и плода является иммунологически уникальным, так как должно обеспечивать толерантность к аллогенному плоду и в то же время поддерживать защиту от возможных патогенов. Клинические исследования показали сильную взаимосвязь между внутриматочной бактериальной и вирусной инфекцией и такими осложнениями беременности, как выкидыши, преждевременные роды, задержка внутриутробного развития плода и поздний гестоз (Arechavaleta-Velasco F., Gomez L., Ma Y. et al. Adverse reproductive outcomes in urban women with adeno-associated virus-2 infections in early pregnancy//Hum. Reprod.- 2008. - Vol.- P. 23, 29-36). Таким образом, воспалительный ответ может оказывать огромное влияние на течение беременности.

Выбор определения экспрессии Циклооксигеназы-2 (COX-2) и Каспазы-3α (CASP-3α) в качестве диагностического метода невынашивания беременности связан с высокой специфичностью метода, так как COX-2 является основным ферментом синтеза простагландинов, а CASP-3α является эффекторной протеазой, участвующей в процессе апоптоза (Ахматова Н.К., Киселевский М.В. Врожденный иммунитет: противоопухолевый и противоинфекционный//М.: Практическая медицина, 2008. - 255 с.; Horne A., Stock S., King A. Innate immunity and disorders of female reproductive tract//Reproduction. - 2008. - Vol.135. - P. 739-749).

Так как методов ранней диагностики невынашивания беременности на основании экспрессии CASP-3α и СОХ-2 не выявлено, за аналоги были взяты методы диагностики невынашивания беременности, основанные на определении других иммунологических показателей.

Известен способ прогнозирования невынашивания беременности ранних сроков инфекционного генеза (RU №2444734, опубл. 10.03.2012), основанный на определении уровня растворимой формы рецептора sFlt-1 в сыворотке крови беременной в 1 триместре. При его величине, равной 0,389 нг/мл или ниже, прогнозируют прерывание беременности. Способ позволяет снизить угрозу перинатальных потерь за счет своевременного выявления беременных группы риска и начала адекватных лечебных мероприятий.

Данный способ имеет недостатки. Забор материала для исследования осуществлялся у женщин, имеющих сопутствующую гинекологическую патологию, что, в свою очередь, не дает достоверных данных о том, что именно путем данного способа возможно прогнозирование невынашивания беременности.

Известен способ прогнозирования невынашивания в 1 триместре беременности (RU №2341800, опубл. 20.12.2008), основанный на определении содержания субстанции P(SP) и фактора некроза опухоли (FNO) в сыворотке крови беременной методом ИФА. Затем по формуле рассчитывают прогностический коэффициент К. Если значение прогностического коэффициента К больше, чем 0,48, то у данной беременной прогнозируют угрозу прерывания беременности. Использование способа позволяет повысить точность, чувствительность и специфичность прогнозирования течения первого триместра беременности. Недостатком данного способа является его трудоемкость.

Также существует способ прогнозирования невынашивания во втором триместре беременности (RU №2340899, опубл. 10.12.2008), основанный на определении содержания трансформирующего фактора роста-2 (ТФР-2) в сыворотке крови беременной. Если ТФР-2 меньше 1806,8 пг/мл, то прогнозируют угрозу прерывания беременности. В случае, если ТФР-2 больше 1806,8 пг/мл, то дополнительно определяют уровень субстанции Р (SP) и, если он больше 0,274 нг/мл, то также прогнозируют угрозу прерывания беременности во втором триместре. Использование способа позволяет повысить точность, чувствительность и специфичность прогнозирования течения второго триместра беременности. Недостатками данного способа являются его недостаточная специфичность и высокая трудоемкость.

Известен способ прогнозирования невынашивания беременности на прегравидарном этапе (RU №2184968, опубл. 10.07.2002), в котором проводят исследование иммуногенетического профиля лейкоцитов периферической крови в супружеской паре, при этом на основе показателей HLA-антигенов I, II классов определяют дискриминантную функцию F по формуле

F (x)=0,78·A1+0,74·A9+0,77·A11+1,71·A28-0,94·A29-0,95·B21+5,04·B39-

-1,54·B57-1,87·B65-0,22·Dr5+1,39·Dr7-0,83·MA9+0,56·MA10-1,12·MA28+

+1,73·MA29-0,74·MB5+0,56·MB7+0,71·MB8+1,11·MB12+1,62·MB14-

-0,65·MB27-0,61·MB53-0,83·MDr2-1,60·MDr3-0,51·MDr5-0,67·MDr7-0,46,

где А1, А9, А11, А28, А29 - гены А локуса жены, МА9, МА10, МА28, МА29 - гены А локуса мужа, В21, В39, В57, В65 - гены В локуса жены, МВ5, МВ7, МВ8, МВ12, МВ14, МВ27, МВ53 - гены В локуса мужа, Dr5, Dr7 - гены Dr локуса жены, MDr2, MDr3, MDr5, MDr7 - гены Dr локуса мужа, N - норма, если F (x)>0, P - патология, если F (x)<0. Полученная функция обеспечивает чувствительность решающего правила прогноза 79,4%, специфичность 81%, эффективность 80,7%. Недостатком способа является длительность и трудоемкость его выполнения.

Существуют способы прогнозирования поздних выкидышей. Так, описан способ (RU №2465589, опубл. 27.10.2012), основанный на определении концентрации фактора некроза опухоли альфа (TNF), интерлейкина-1 (IL-1), интерлейкина-6 (IL-6) в сыворотке крови беременной. Дополнительно определяют количество лимфоцитов CD95+(L CD95+), уровень фертильности альфа-2-микроглобулина (FAMB), концентрацию фактора роста плаценты (PGF) и общего IgE. Если полученные значения соответствуют следующим показателям: концентрация TNF (пкг/мл) - 294±39,5; концентрация IL-1 (пкг/мл) - 588±46,3; концентрация IL-6 (пкг/мл) - 85,2±13,1; количество L CD95+ (%) - 14,1±5,2, уровень FAMB (нг/мл) - 215±42, уровень PGF (пкг/мл) - 21±6,2; содержание общего IgE (пкг/мл) - 68±24, то прогнозируется поздний выкидыш. Недостатком этого способа является его низкая чувствительность.

Задачей настоящего изобретения является разработка высокоточного способа прогнозирования невынашивания беременности на основании экспрессии CASP-3α и СОХ-2, пригодного для применения в амбулаторных условиях.

Технический результат - получение критериев оценки риска развития невынашивания беременности, позволяющих определить клинический прогноз и тактику ведения женщины во время беременности, позволяющий снизить экономические затраты и уменьшить количество койко-дней пребывания пациенток в гинекологическом отделении.

В соответствии с поставленной задачей был разработан способ раннего прогнозирования невынашивания беременности, основанный на определении экспрессии CASP-3α и COX-2, включающий:

- выделение рибонуклеиновой кислоты (РНК) из эпителиальных клеток цервикального канала у женщин на ранних сроках беременности;

- обратную транскрипцию с получением кДНК;

- определение экспрессии CASP-3α и COX-2 с помощью количественной полимеразной цепной реакции;

- прогнозирование вероятности невынашивания беременности по уравнениям линейной дискриминантной функции следующего вида:

у1=-0,8383+155,755*x1+27,2986*x2,

у2=-207,714+3007,030*x1+533,609*x2,

где x1 - уровень экспрессии мРНК CASP-3α (отн.ед.), x2 - уровень экспрессии мРНК COX-2 (отн.ед.);

- прогнозирование развития невынашивания беременности ранних сроков, если y1 больше y2;

- прогнозирование прогрессирующей беременности в случае, если y2 больше, чем y1.

Новизна и изобретательский уровень заключается в том, что в настоящее время не известна возможность раннего прогнозирования невынашивания беременности на основании определения экспрессии CASP-3α и COX-2.

Способ осуществляют следующим образом.

Определение экспрессии мРНК CASP-3α и COX-2 проводили методом количественной ПЦР в НИЛ «Молекулярная генетика человека» НИУ «БелГУ».

Материалом для определения экспрессии CASP-3α и COX-2 с целью ранней диагностики невынашивания беременности являются клетки эпителия цервикального канала. Способ разработан с учетом стандарта MIQE (Bustin S., Benes V., Garson G. et al. The MIQE Guidelines: Minimum information for publication of quantitive Real-Time PCR experiments//Clin. Chem. - 2009. - №55, Vol.4. - P. 611-622).

Взятие материала у беременных женщин проводили на сроке беременности 6-10 недель. Группу с невынашиванием составили 100 пациенток с самопроизвольными выкидышами на сроке 6-10 недель, контрольную группу - 60 пациенток, которым был произведен медаборт на тех же сроках.

Шейку матки обнажали в зеркалах, стерильным тампоном удаляли слизь из цервикального канала. Затем с помощью цитощетки производили сбор материала в пробирку Эппендорфа объемом 1,5 мл, содержащую 500 мкл консервирующей среды RNAlater (Ambion).

Если есть необходимость в хранении материала, после помещения материала в раствор RNAlater пробирки оставляют в холодильнике при температуре +4ºС на 1 сутки, затем помещают в морозильную камеру и в дальнейшем хранят при температуре -28ºС. После размораживания образцов сливают надосадочную жидкость и приступают к выделению РНК.

Для выделения РНК из образцов пробирки размораживали при комнатной температуре, затем центрифугировали на 12000 об в течение 5-10 минут, надосадочную жидкость удаляли. Полученный осадок представлял собой взвесь эпителиальных клеток, которые были пригодны для выделения РНК.

После размораживания проб экстракцию РНК проводили методом фенол-хлороформной экстракции, описанным производителем, с использованием реагента Тризол (“Invitrogen”, США).

Качество РНК проверяли методом электрофореза в течение 15 минут при напряжении 10 В/см по интенсивности свечения полос рибосомальной РНК в 1,1% агарозном геле с бромистым этидием. Затем образцы обрабатывали ДНКазой DNAse I RNAse free (“Fermentas”, США) для удаления геномной ДНК согласно инструкции производителя.

Для проведения обратной транскрипции использовали обратную транскриптазу Mint (“Евроген”, Россия). Для инициации реакции использовали олигодезоксинуклеотиды (oligoDT), синтезированные фирмой «Евроген». В реакцию вносили 500 нг РНК, предварительно прогретой до 55 градусов (концентрацию мРНК проверяли на спектрофотометре Nanodrop (“ThermoScientific”, США), и 4 мкл oligoDT (20 мкМ), обратную транскрипцию проводили согласно инструкции производителя.

Качество полученной кДНК оценивали с помощью гель-электрофореза в 1,1% агарозном геле с бромистым этидием. Для дальнейшей ПЦР использовали разведение полученной кДНК со стерильной водой в объеме 2 к 50.

Для количественной ПЦР подбор праймеров генов осуществлялся с помощью базы данных BLAST (www.ncbi.nlm.nih.gov). Одним из условий поиска праймеров было отличие температуры амплификации прямого и обратного праймера не более 2ºС. Все полученные пары праймеров были протестированы на возможность образования «шпилек» и димеров с помощью программы Beacon Designer Free Edition (http://www.premierbiosoft.com/qOligo/Oligo.jsp?PID=1). Кроме того, с целью тестирования на димеры праймеров в программу для ПЦР был добавлен этап анализа кривой плавления (melt curve). Были выбраны следующие праймеры (табл.3). Среди всех генов-нормировщиков по данным литературы (Aflatoonian R., Tuckerman E., Elliott S.L. et al. Menstrual cycle-dependent changes of Toll-like receptors in endometrium//Hum. Reprod. - 2007. - Vol.22. - P. 586-593) и базы данных RT-Primer Database (http://www.rtprimerdb.org/) были выбраны наиболее стабильно экспрессируемые в эпителиоцитах шейки матки и эндометрия гены и проведена их оценка с помощью программы GeNorm-Plus (www.biogazelle.com). В качестве генов-нормировщиков были выбраны бета-актин (beta-actin) и пептидилпропилизомеразаа (PPIA).

Таблица 1
Праймеры для количественной ПЦР
Наименование
гена
Прямой праймер Обратный праймер T отжига, ºС
1 CASP-3α GTGCTATTGTGAGGCGGTTG CACGGATACACAGCCACAGG 55
2 COX-2 ATCTACGGTTTGCTGTGGGG TTCTGTACTGCGGGTGGAAC 57
3 β-актин CAGGCACCAGGGCGTGATGG GATGGAGGGGCCGGACTCGT 64
4 PPIA CCGCCGAGGAAAACCGTGTACT TGGACAAGATGCCAGGACCCGT 64

Для ПЦР в режиме реального времени использовали смесь qPCRmix-HS SYBR с интеркалирующим красителем SYBRI, в который входит высокопроцессивная Taq-полимераза с горячим стартом, смесь нуклеотидтрифосфатов, магний и буферный раствор.

Для приготовления смеси на одну пробирку вносили 2 мклкДНК, по 2 мкл прямого и обратного праймера, 5 мкл смеси qPCRmix-HS SYBR, 14 мкл стерильной воды. Амплификацию проводили на амплификаторе CFX96 («Biorad», США).

Режим амплификации:

1. Предварительная денатурация - 1 цикл 95ºС 5 мин;

2. Денатурация - 1 цикл 95ºС 30 с;

3. Отжиг при соответствующей каждому праймеру температуре (см. таблицу) - 30 с;

4. Элонгация при 68ºС - 30 с.

Количество циклов - 50.

Дополнительным этапом после амплификации была добавлена кривая плавления (melt curve) от 55 до 95 градусов по 6 секунд с целью детекции возможных димеров праймеров.

Полученные результаты выражали в относительных единицах (relative units), вычисляя их по формуле

R=2((Cqref1+Cqref2)/2 - Cqtarget),

где R - нормализованная экспрессия мРНК исследованных генов, Cqref1 и Cqref2 - Cq генов-нормировщиков, Cq target - Cq исследованного гена конкретной женщины.

Статистическую обработку результатов проводили с использованием программы «Statistica 6.0».

Проверка нормальности распределения признаков проводилась с помощью критерия Колмогорова-Смирнова и Шапиро-Уилка.

В случае нормального распределения выборки по данному признаку результат представляли как среднее арифметическое±среднеквадратическое отклонение (M±σ). Для оценки достоверности различий признаков, подчиняющихся закону нормального распределения, использовали t-критерий Стъюдента для двух независимых выборок. В случае отсутствия нормального распределения выборки результат представляли как медиану (нижний квартиль; верхний квартиль). Для корреляционного анализа использовали критерий Спирмена. Различия считали статистически достоверными при уровне значимости p<0,05.

Для создания индивидуального прогноза невынашивания беременности ранних сроков на основании экспрессии CASP-3α и СОХ-2 использовали метод дискриминантного анализа (табл.2).

Таблица 2
Информативные признаки и их коэффициенты дискриминантного сравнительного анализа при самопроизвольных выкидышах и прогрессирующей беременности раннего срока для COX-2 и CASP-3α, N=114, F (2,5)=231,97, p<0,00001
Признак
N=114
F-критерий p-уровень Коэффициенты признака
Невынашивание Прогрессирующая беременность
CASP-3α 267,8731 0,000016 155,7550 3007,030
COX-2 83,3752 0,000264 27,2986 533,609
Constant -0,8383 -207,714

В таблице 2 приведены коэффициенты признаков, которые необходимы для подстановки их в 2 дискриминантных уравнения, которые имеют вид:

- определение значений y1 и y2 по уравнениям линейной дискриминантной функции следующего вида:

у1=-0,8383+155,755*x1+27,2986*x2,

у2=-207,714+3007,030*x1+533,609*x2,

где x1 - уровень экспрессии мРНК CASP-3α (отн.ед.), x2 - уровень экспрессии мРНК COX-2 (отн.ед.);

- прогнозирование развития невынашивания беременности ранних сроков, если y1 больше y2;

- прогнозирование прогрессирующей беременности в случае, если y2 больше, чем y1.

Было обследовано 57 пациенток с самопроизвольными выкидышами на сроках 6-10 недель и 57 пациенток с прогрессирующей беременностью того же срока. Методом количественной ПЦР определяли экспрессию мРНК CASP-3α и COX-2 в эпителии цервикального канала.

В таблице 3 приведена матрица классификации анализа, из которой видно, что 91,22% женщин с самопроизвольными выкидышами ранних сроков были правильно классифицированы, а в группе с прогрессирующей беременностью - 92,98%. Качество распознавания в данной модели составило 92,10%. Достоверность модели была высокой (F=231,97, p<0,00001).

Таблица 3
Матрица классификации дискриминантного анализа
Группа Невынашивание Прогрессирующая
беременность
Всего, % Качество
распознавания, %
CASP-3α 91,22% 8,77% 100 91,22%
COX-2 7,77% 92,98% 100 92,98%
Всего 98,99% 101,75% 200 92,10%

Таким образом, предложенное изобретение работоспособно и позволяет эффективно прогнозировать невынашивание беременности в 92,10% случаев. Применение данного способа позволит своевременно реализовывать необходимые лечебно-профилактические мероприятия по предупреждению невынашивания беременности.

Способ раннего прогнозирования невынашивания беременности, включающий выделение РНК из эпителиальных клеток цервикального канала у женщин, проведение обратной транскрипции с получением кДНК, определение экспрессии CASP-3α и COX-2 с помощью количественной полимеразной цепной реакции и прогноз вероятности невынашивания беременности по уравнениям линейной дискриминантной функции следующего вида:у=-0,8383+155,755*x+27,2986*x,у=-207,714+3007,030*x+533,609*x,где x - уровень экспрессии мРНК CASP-3α (отн. ед.), x - уровень экспрессии мРНК COX-2 (отн. ед.), при этом прогнозируют развитие невынашивания беременности ранних сроков, если y больше y, и прогнозируют прогрессирование беременности в случае, если y больше, чем y.
Источник поступления информации: Роспатент

Showing 1-10 of 116 items.
20.01.2013
№216.012.1daa

Способ оценки эффективности терапии у больных хроническим гломерулонефритом

Изобретение относится к медицине, а именно к урологии и молекулярной диагностике, и касается способа оценки эффективности терапии циклофосфамидом у больных хроническим гломерулонефритом. Отбирают венозную кровь, выделяют ДНК и выявляют носительство аллелей локуса +1931 А/Т MIP-1β. В случае...
Тип: Изобретение
Номер охранного документа: 0002473088
Дата охранного документа: 20.01.2013
27.01.2013
№216.012.20db

Способ прогнозирования уровня артериального давления у беременных в зависимости от генетического полиморфизма эндотелина 1

Изобретение относится к области медицины. Предложен способ прогнозирования уровня артериального давления у беременных, включающий выделение ДНК из лимфоцитов периферической венозной крови и анализ полиморфизма K198N гена эндотелина 1 (ЕТ-1) методом полимеразной цепной реакции. В случае...
Тип: Изобретение
Номер охранного документа: 0002473912
Дата охранного документа: 27.01.2013
20.03.2013
№216.012.3026

Способ ранней диагностики послеродового эндометрита

Изобретение относится к области медицины. Предложен способ ранней диагностики послеродового эндометрита, включающий выделение РНК из эпителиальных клеток цервикального канала у женщин на поздних сроках беременности или на 3-4 сутки после родов, проведение обратной транскрипции с получением кДНК...
Тип: Изобретение
Номер охранного документа: 0002477861
Дата охранного документа: 20.03.2013
27.04.2013
№216.012.3b62

Способ прогнозирования риска развития доброкачественной дисплазии молочной железы у женщин с генитальным эндометриозом

Настоящее изобретение относится к области медицины, в частности к молекулярно-генетическим исследованиям, и описывает способ прогнозирования риска развития доброкачественной дисплазии молочной железы у женщин с генитальным эндометриозом, включающий выделение ДНК из периферической венозной...
Тип: Изобретение
Номер охранного документа: 0002480763
Дата охранного документа: 27.04.2013
10.11.2013
№216.012.7f80

Способ прогнозирования общей выживаемости больных хроническим лимфолейкозом

Изобретение относится к области медицины. Предложен способ прогнозирования общей выживаемости больных хроническим лимфолейкозом. Осуществляют выделение ДНК из периферической венозной крови, анализ полиморфизма -590С/Т гена интерлейкина 4, -174G/C гена интерлейкина 6 и выявление наличия...
Тип: Изобретение
Номер охранного документа: 0002498313
Дата охранного документа: 10.11.2013
20.02.2014
№216.012.a34c

Способ прогнозирования течения острого панкреатита

Изобретение относится к области медицины и предназначено для прогнозирования сроков наступления реактивной фазы острого панкреатита. Осуществляют выделение ДНК из периферической венозной крови, проводят анализ полиморфизма гена фактора некроза опухоли α и при выявлении генотипов -308 АА или...
Тип: Изобретение
Номер охранного документа: 0002507519
Дата охранного документа: 20.02.2014
20.02.2014
№216.012.a34d

Способ прогнозирования риска развития диабетической ангиопатии нижних конечностей у больных сахарным диабетом 2 типа

Изобретение относится к области медицины и предназначено для прогнозирования риска развития ангиопатии нижних конечностей у больных сахарным диабетом 2-го типа. Осуществляют выделение ДНК из периферической венозной крови, проводят анализ полиморфизма -308G/A гена фактора некроза опухоли α и при...
Тип: Изобретение
Номер охранного документа: 0002507520
Дата охранного документа: 20.02.2014
27.02.2014
№216.012.a74c

Способ прогнозирования риска развития тромбоцитопении в течении хронического лимфолейкоза

Изобретение относится к области медицинской диагностики, может быть использовано для прогнозирования риска развития тромбоцитопении в течение хронического лимфолейкоза. Способ прогнозирования риска развития тромбоцитопении в течение хронического лимфолейкоза включает выделение ДНК из...
Тип: Изобретение
Номер охранного документа: 0002508543
Дата охранного документа: 27.02.2014
27.02.2014
№216.012.a752

Способ прогнозирования сроков формирования абсцесса при остром панкреатите

Изобретение относится к области медицинской диагностики и может быть использовано для прогнозирования сроков формирования абсцесса в фазу секвестрации острого панкреатита и, как следствие, неблагоприятного течения заболевания. Способ прогнозирования сроков формирования абсцесса в фазу...
Тип: Изобретение
Номер охранного документа: 0002508549
Дата охранного документа: 27.02.2014
27.06.2014
№216.012.d880

Способ прогнозирования риска развития сахарного диабета второго типа у больных гипертонической болезнью

Изобретение относится к области медицины и предназначено для прогнозирования риска развития сахарного диабета второго типа у уроженцев Центрального Черноземья, больных гипертонической болезнью. Осуществляют выделение ДНК и проводят анализ полиморфного варианта гена лимфотоксина α (+250G/A Ltα)....
Тип: Изобретение
Номер охранного документа: 0002521202
Дата охранного документа: 27.06.2014
Showing 1-10 of 139 items.
20.01.2013
№216.012.1daa

Способ оценки эффективности терапии у больных хроническим гломерулонефритом

Изобретение относится к медицине, а именно к урологии и молекулярной диагностике, и касается способа оценки эффективности терапии циклофосфамидом у больных хроническим гломерулонефритом. Отбирают венозную кровь, выделяют ДНК и выявляют носительство аллелей локуса +1931 А/Т MIP-1β. В случае...
Тип: Изобретение
Номер охранного документа: 0002473088
Дата охранного документа: 20.01.2013
27.01.2013
№216.012.20db

Способ прогнозирования уровня артериального давления у беременных в зависимости от генетического полиморфизма эндотелина 1

Изобретение относится к области медицины. Предложен способ прогнозирования уровня артериального давления у беременных, включающий выделение ДНК из лимфоцитов периферической венозной крови и анализ полиморфизма K198N гена эндотелина 1 (ЕТ-1) методом полимеразной цепной реакции. В случае...
Тип: Изобретение
Номер охранного документа: 0002473912
Дата охранного документа: 27.01.2013
20.03.2013
№216.012.3026

Способ ранней диагностики послеродового эндометрита

Изобретение относится к области медицины. Предложен способ ранней диагностики послеродового эндометрита, включающий выделение РНК из эпителиальных клеток цервикального канала у женщин на поздних сроках беременности или на 3-4 сутки после родов, проведение обратной транскрипции с получением кДНК...
Тип: Изобретение
Номер охранного документа: 0002477861
Дата охранного документа: 20.03.2013
27.06.2014
№216.012.d880

Способ прогнозирования риска развития сахарного диабета второго типа у больных гипертонической болезнью

Изобретение относится к области медицины и предназначено для прогнозирования риска развития сахарного диабета второго типа у уроженцев Центрального Черноземья, больных гипертонической болезнью. Осуществляют выделение ДНК и проводят анализ полиморфного варианта гена лимфотоксина α (+250G/A Ltα)....
Тип: Изобретение
Номер охранного документа: 0002521202
Дата охранного документа: 27.06.2014
20.11.2014
№216.013.075d

Способ прогнозирования течения и эффективности терапии сахарного диабета 2 типа

Изобретение относится к области медицины и предназначено для прогнозирования течения и эффективности терапии сахарного диабета 2-го типа у индивидуумов русской национальности. После выделения ДНК из периферической венозной крови проводят анализ полиморфного варианта +250A/G гена лимфотоксина α...
Тип: Изобретение
Номер охранного документа: 0002533286
Дата охранного документа: 20.11.2014
20.11.2014
№216.013.0807

Способ прогнозирования уровня гликированного гемоглобина у больных сахарным диабетом 2 типа

Изобретение относится к области медицины и предназначено для прогнозирования уровня гликированного гемоглобина y индивидуумов русской национальности, больных сахарным диабетом 2 типа. После выделения ДНК из периферической венозной крови проводят анализ полиморфного варианта гена рецептора...
Тип: Изобретение
Номер охранного документа: 0002533456
Дата охранного документа: 20.11.2014
10.02.2015
№216.013.2503

Способ прогнозирования риска развития хронической плацентарной недостаточности с синдромом задержки роста плода 2-3-ей степени у беременных

Изобретение относится к области медицины и предназначено для прогнозирования риска развития плацентарной недостаточности с синдромом задержки роста плода 2-3-ей степени у беременных. Осуществляют забор периферической венозной крови и выделение ДНК. Проводят анализ генов факторов коагуляции ,и....
Тип: Изобретение
Номер охранного документа: 0002540928
Дата охранного документа: 10.02.2015
20.05.2015
№216.013.4bdb

Способ прогнозирования риска формирования миомы матки

Изобретение относится к области медицины. Изобретение представляет способ прогнозирования риска развития изолированной миомы матки, включающий забор и исследование периферической венозной крови, отличающийся тем, что из периферической венозной крови выделяют ДНК, проводят типирование...
Тип: Изобретение
Номер охранного документа: 0002550933
Дата охранного документа: 20.05.2015
27.07.2015
№216.013.6717

Способ прогнозирования уровня артериального давления у женщин в конце беременности

Изобретение относится к области медицины и касается способа прогнозирования уровня артериального давления у женщин русской национальности, являющихся уроженками Центрально-Черноземного региона России. Способ включает выделение ДНК из лимфоцитов периферической венозной крови и анализ...
Тип: Изобретение
Номер охранного документа: 0002557944
Дата охранного документа: 27.07.2015
27.07.2015
№216.013.671f

Способ прогнозирования веса новорожденного с учетом полиморфных вариантов локуса 10976 g/afvii

Изобретение относится к медицине, а именно акушерству и может быть использовано для прогнозирования веса новорожденного у женщин русской национальности, являющихся уроженками Центрального Черноземья России. Для этого у пациентки выделяют ДНК из периферической венозной крови и проводят анализ...
Тип: Изобретение
Номер охранного документа: 0002557952
Дата охранного документа: 27.07.2015

Похожие РИД в системе