25.08.2017
217.015.ba43

ДИАГНОСТИЧЕСКАЯ СИСТЕМА ДЛЯ ВЫЯВЛЕНИЯ ДНК ПРОВИРУСОВ ЛЕЙКОЗА И ИММУНОДЕФИЦИТА КРУПНОГО РОГАТОГО СКОТА МЕТОДОМ МУЛЬТИПЛЕКСНОЙ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ

Вид РИД

Изобретение

Юридическая информация Свернуть Развернуть
Краткое описание РИД Свернуть Развернуть
Аннотация: Изобретение относится к области биотехнологии, молекулярной биологии, молекулярно-генетической диагностики вирусных болезней животных. Описан способ выявления ДНК провируса лейкоза и иммунодефицита крупного рогатого скота методом мультиплексной ПЦР. Также описан набор для осуществления этого способа, содержащий две пары прямых и обратных олигонуклеотидных праймеров для выявления провирусов энзоотического лейкоза и иммунодефицита крупного рогатого скота. Предложенная группа изобретений может быть использована в научных исследованиях и ветеринарии. 2 н.п. ф-лы, 5 ил., 3 табл., 2 пр.
Реферат Свернуть Развернуть

Изобретение относится к области биотехнологии, молекулярной биологии, молекулярно-генетической диагностики вирусных болезней животных для одновременного обнаружения провирусов лейкоза и иммунодефицита крупного рогатого скота в лимфоцитах крови животных методом мультиплексной полимеразной цепной реакции (ПЦР) и может быть использовано в научных исследованиях.

Семейство Retroviridae включает два патогенных для крупного рогатого скота (КРС) вируса: Bovine immunodeficiency virus (BIV) и Bovine leukemia virus (BLV). Ретровирусные инфекции КРС широко распространены в мире. В эндемичных регионах инфицированность животных ретровирусами значительна и постоянно увеличивается. Согласно мировым исследованиям, инфицированность молочных стад в Японии составляет 79.1% (Sota Kobayashi, Toshiyuki Tsutsui, Takehisa Yamamoto, Yoko Hayama, Ken-ichiro Kameyama, Misako Konishi, Kenji Murakami. Risk factors associated with within-herd transmission of bovine leukemia virus on dairy farms in Japan // Veterinary Research. - 2010. - 6), в Алматинской области доходит до 75,2% (К.Н. Мукантаев, К.К. Муканов, А.В. Шустов, К. Турсунов, Ш. Байдосова Современные аспекты серологической диагностики энзоотического лейкоза крупного рогатого скота // Биотехнология. Теория и практика. №3 2012. - С. 3-15).

Вирус иммунодефицита действует как иммуносупрессор, снижая устойчивость животных к другим инфекциям и инвазиям, так как поражает центральное звено иммунной системы - Т-хелперы. Возбудитель энзоотического лейкоза также угнетает иммунную систему, так как паразитирует в мононуклеарах крови, поражая преимущественно В-лимфоциты. В результате резко снижаются адаптивные возможности организма, специфическая и неспецифическая резистентности, что неизбежно приводит к развитию патологического процесса (Вирусология Т. 1: Пер. с англ. / Под ред. Б. Филдса, Д. Найпа, при участии Р. Ченока, Б. Ройзмана, Дж. Мелника, Р. Шоупа. - М.: Мир, 1989. - 492 с.).

Часто данные возбудители обнаруживаются у одного и того же животного в виде микстинфекции (Ларионова О.С., Красников А.В., Утанова Г.Х. Анализ инфицированности крупного рогатого скота ретровирусными инфекциями в Саратовской области // Аграрный научный журнал. №2/2015. С. 17-19.). По мнению ряда исследователей, это является следствием того, что энзоотический лейкоз крупного рогато скота (ЭЛ КРС) является BIV-ассоциированной инфекцией, при этом коинфекция обоими ретровирусами значительно усугубляет тяжесть течения заболевания и значительно снижает качество продукции животноводства (Snider TG, Luther DG, Jenny BF, Hoyt PG, Battles JK, Ennis WH, Balady J, Blas-Machado U, Lemarchand TX, Gonda MA. Encephalitis, lymphoid tissue depletion and secondary diseases associated with bovine immunodeficiency virus in a dairy herd. Comp Immunol Microbiol Infect Dis. 1996 Feb; 19(2): 117-131.; Snider, T.G., D.G. Luther, B.F. Jenny, P.G. Hoyt, J.K. Battles, W.H. Ennis, J. Balady, U. Blas-Machado, Т.X. Lemarchand, and M.A. Gonda. 1996. Encephalitis, lymphoid tissue depletion and secondary diseases associated with bovine immunodeficiency virus in a dairy herd. Сотр. Immunol. Microbiol. Infect. Dis. 19: 117-131).

Распространение ретровирусных инфекций среди скота приводит к значительному экономическому ущербу, складывающемуся из снижения количества и качества молочной и мясной продукции, падежа или вынужденного убоя животных, недополучения молодняка, а также потери его племенной ценности и ограничения в реализации, затрат на проведение противоэпизоотических мероприятий и обеззараживание молока (Галеев Р.Ф., Хусаинов Р.Ф. Лейкоз крупного рогатого скота. Уфа: Издательство «Новый стиль». 2009 г. - 220 с.).

Наиболее часто ретровирусы поражают высокопродуктивных молочных коров. Из-за возможности инфицирования клеток человека BLV - вирусом лейкоза крупного рогатого скота молоко от клинически больных лейкозом коров запрещено для питания (Buehring, G.C. Humains have antibodies reactive with Bovine Leukemia virus // G.C. Buehring, S.M. Philpott, K.Y. Choi // AIDS. Res. Hum. Retroviruses, 2003. V. 19. - P. 1105-1113). Молоко от носителей нельзя давать детям, оно разрешено к переработке только после обеззараживания (Правила по профилактике и борьбе с лейкозом крупного рогатого скота, Приказ Минсельхозпрода РФ от 11.05.1999 N 359).

При инфицировании крупного рогатого скота вирусом энзоотического лейкоза организм отвечает на заражение специфической реакцией - образованием антител, сроки выявления которых зависят от дозы вируса, а также от индивидуальных особенностей иммунной системы. Первые антитела могут быть обнаружены через 3-16 недель после заражения (Воробьев А.Л., Антюхов В.М. Лейкоз КРС: диагностика и проблемы оздоровления // Передовые технологии: Ветеринарная медицина http://borona.net/hight-technologies/veterinary/Lejkoz_KRS_diagnostika_i_problemy_ozdorovlenija.html).

У большинства отелившихся инфицированных коров снижается титр сывороточных антител на фоне высоких титров защитных иммуноглобулинов в молозиве. Восстановление происходит в основном через 14-30 суток, однако у 10% из этих животных сероконверсия может отсутствовать до 3 месяцев (Greinex М., Gardner I.A. Epidemiologic issues in the validation of veterinary diagnostic tests // Prev. Vet. Med. - 2000. - 45. - P. 3-22).

Возбудители энзоотического лейкоза и вирусного иммцнодефицита крупного рогатого скота обладают интегративным типом взаимодействия с клеткой, вирусы персистируют в организме пожизненно в виде провирусов, интегрированных в геном лимфоцитов хозяина, при этом свободные зрелые вирионы или их антигены, как правило, отсутствуют, что делает возбудителей «невидимыми» для иммунной системы, следовательно, индукции иммунного ответа может не быть (Супотницкий М.В. Эволюционная патология. К вопросу осмеете ВИЧ-инфекции и ВИЧ/СПИД-пандемии среди других инфекционных, эпидемических и пандемических процессов. - Москва: Вузовская книга, 2009. - 400 с.).

Метод ПЦР направлен на обнаружение ДНК возбудителя в исследуемом материале, что позволяет выявлять и исключать из эпизоотической цепи не только больных животных, но и латентных носителей вируса. Метод ПЦР обладает высокой чувствительностью и специфичностью, подходит для рутинной диагностики благодаря возможности автоматизации. Универсальность постановки реакции позволяет осуществлять многопараметрический анализ одного и того же объекта, например выявлять одновременно вирус лейкоза и иммунодефицита в лимфоцитах периферической крови животных (мультиплексная ПЦР). Специфичность метода ПЦР определяют праймеры - олигонуклеотиды, комплементарные части уникального и наиболее консервативного фрагмента вирусного генома. В случае применения мультиплексной ПЦР, к структуре праймеров предъявляют следующие требования:

- комплементарность выбранному фрагменту;

- отсутствие взаимо- и самокомплементарности;

- GC-состав ~ 40-60%;

- близкие температуры плавления праймеров;

- близкие температуры отжига праймеров;

- формирование ампликонов, отличающихся по размеру для каждой пары праймеров.

Известен способ диагностики лейкоза крупного рогатого скота, включающий выявление положительно реагирующих в реакции иммунодиффузии животных, гематологический метод исследования, у инфицированных животных определение процентного содержания Т-лимфоцитов методом спонтанного розеткообразования с эритроцитами барана (патент RU №2465588, опубликован 27.10.2012 г.).

Недостатками данного метода являются трудоемкость, многооперационность, невозможность обнаруживать латентных носителей вируса лейкоза - BLV и выявлять при этом животных, инфицированных BIV - возбудителем вирусного иммунодефицита крупного рогатого скота.

Известен способ определения антител к BIV и BLV в сыворотки крови животных методом ТИФА (твердофазный иммуноферментный анализ), основанный на обнаружении специфического комплекса антиген-антитело с помощью цветной реакции вследствие ферментирования субстрата энзимом, связанным с коньюгатом (L. Zheng, М. Swanson, J. Liao, С. Wood, S. Kapil, R. Snider, T.A. Loughin, and H.C. Cloning of the Bovine Immunodeficiency Virus gag Gene and Development of a Recombinant-Protein-Based Enzyme-Linked Immunosorbent Assay. Minocha Clin Diagn Lab Immunol. 2000 July; 7(4): 557-562; Gutierrez G., Alvarez I., Fondevila N., Politzki R., Lomornaco M., Rodriguez S., Dus Santos M.J., Trono Veterinary K. Detection of bovine leukemia virus specific antibodies using recombinant p24-ELISA // Microbiology. - 2009. - №137. - P. 224-234).

Недостатками метода являются невысокая информативность на ранних этапах заражения и в период физиологического изменения иммунологической реактивности организма, а также невозможность одновременного исследования на лейкоз и иммунодефицит КРС.

Известен способ обнаружения провирусов BIV и BLV в крови животных методом «гнездной» ПЦР, основанный на использовании 2-х пар праймеров при выявлении каждого из провирусов: «внешние» для первой амплификации и «внутренние» для второй амплификации (Brujeni GN, Poorbazargani ТТ, Nadin-Davis S, Tolooie M, Barjesteh N. Bovine immunodeficiency virus and bovine leukemia virus and their mixed infection in Iranian Holstein cattle.J Infect Dev Ctries. 2010 Oct 4; 4(9): 576-9).

Недостатками метода являются высокий риск контаминации образцов, реактивов, помещения и оборудования лаборатории образующимися ампликонами при проведении двухэтапной амплификации, многостадийность анализа и невозможность одновременного выявления BIV и BLV провирусов.

Известен способ тестирования вируса лейкоза КРС у крупного рогатого скота и в мясомолочных продуктах питания, включающий выделение ДНК (или получение кДНК), амплификацию с использованием флуоресцентно меченых праймеров BLV-F9 (5'AAAGACTCGCCAGACGCCT) и BLV-R8 (5'ATTGGGGATGAGATCTGCAA) и TaqMan-зонда BLV-PR2 (5'AAGACTCGCCAGACGCCTTCG), тестирование продуктов амплификации с помощью электрофоретического анализа или измерения уровня флуоресценции на флуориметре «Джин» (заявка на изобретение RU №2012144762, опубликована 27.04.2014 г.).

Недостатками метода являются необходимость использования флуоресцентной метки, что приводит к удорожанию анализа, снижению срока годности реактивов и необходимости использовать дополнительное оборудование для учета результатов, а также невозможность одновременного выявления провирусов BIV и BLV из-за неспецифичности праймеров для BIV.

Наиболее близким к заявленному изобретению является патент RU №2445370 от 28.10.2010, опубликован 20.03.2012 г., в котором для выявления провируса лейкоза крупного рогатого скота используют прямой и обратный олигонуклеотидные праймеры следующей структуры - PF2: 5'-TGA ACG GAC AAA TGG ACT GCT C-3'; PR2: 5'-CCG АСА GAG AGC GAG GAG AG-3', у которых отсутствуют самокоплементарные участки внутри каждого праймера и между прямым и обратным, температура отжига составляет 66°С для обоих олигонуклеотидов, GC состав - 50% для PF2 и 65% для PR2, и которые фланкируют область консервативного гена pol вируса лейкоза крупного рогатого скота размером 438 пар нуклеотидов. Полимеразную цепную реакцию проводят в объеме реакционной смеси - 25 мкл на 1 пробу ДНК следующего состава: буфер ПЦР (15 мМ MgCl) 5 мкл, дНТФ(10 мМ) 1 мкл, праймер PF2 (10 пмоль/мкл) 1 мкл, праймер PR2(10 пмоль/мкл) 1 мкл, полимераза Taq (5 ед./мкл) 0,2 мкл, вода (бидистиллированная) 11,8 мкл, проба ДНК 5 мкл. Температурно-временной режим проведения реакции для амплификатора «Терцик» («ДНК-технология», Россия): 95°С - 3 минуты; 94°С - 20 секунд, 62°С - 30 секунд, 72°С - 1 минута (цикл повторить 35 раз); 72°С - 3 минуты; 10°С - хранение. Проводят электрофоретическое определение размера амплифицируемого фрагмента нуклеотидной последовательности.

Но данный способ не может быть использован для выявления одновременно провируса иммунодефицита и лейкоза КРС из-за неспецифичности праймеров для BIV, что приводит к затратам времени и реактивов на проведение дополнительных исследований.

Технической задачей является разработка быстрого, высокоспецифичного и чувствительного, не дорогостоящего способа одновременного обнаружения ДНК провирусов энзоотического лейкоза и вирусного иммунодефицита крупного рогатого скота методом мультиплексной ПЦР путем формирования реакционной смеси, подбора условий для проведения ПЦР с ней, включающего минимальное количество манипуляций, что снижает риск контаминации в лаборатории при проведении анализа.

Технический результат заявляемого изобретения заключается в формировании реакционной смеси, включающей две пары специфических олигонуклеотидных праймеров, комплементарных один - участку консервативной области генома BIV, другой - консервативной области генома BLV, и подбора условий проведения мультиплексной ПЦР с ними. Это обеспечивает максимальную информативность, чувствительность и специфичность метода, минимизацию контаминации в лаборатории, а также возможность одновременно выявлять оба патогена.

Техническая задача решается, а технический результат достигается за счет одновременного использования двух пар прямых и обратных олигонуклеотидных праймеров для выявления провируса лейкоза КРС (pBLVf и pBLVr) и провируса иммунодефицита КРС (pBIVf и pBIVr), у которых отсутствуют самокоплементарные участки внутри каждого праймера и между прямым и обратным, проведения ПЦР в объеме реакционной смеси 25 мкл на 1 пробу ДНК и электрофоретического определения размера амплифицируемого фрагмента нуклеотидной последовательности. При этом праймеры отличаются тем, что имеют следующий нуклеотидный состав (5'-3'-):

pBLVf - TATTCCACCCTCGCAAGGC и

pBLVr - GGGCAGTTGATCCAGAGTCGT;

pBIVf - GTCTTCCCACATCCGTAACATCTCCT и

pBIVr - CCCCAGGTCCCATCAACATTCATCAG,

температура отжига составляет 58°С для обоих пар олигонуклеотидов, GC состав - 50,5% для BIV и 56,5% для BLV, и фланкируют область консервативного гена tax провируса лейкоза КРС (pBLVf и pBLVr) размером 609 пар нуклеотидов (п.н.) и область консервативного гена gag провируса иммунодефицита КРС (pBIVf и pBIVr) размером 382 п.н. Реакционная смесь отличается тем, что имеет следующий состав: буфер 10-кратный для ПЦР - 2,5 мкл, дНТФ (25 мМ) - 0,4 мкл, праймеры pBLVf, pBLVr, pBIVf и pBIVr (10 пмоль/мкл) по 1 мкл, Taq полимераза (5 ед./мкл) - 0,2 мкл, MgCl2 (50 мМ) - 1,5 мкл, бидистиллированной воды - 11,4 мкл и пробы ДНК - 5 мкл. При этом амплификацию проводят в следующем режиме: тотальная денатурация 95°С - 3 мин, цикл денатурация (95°С - 20 или 60 сек) - отжиг (58°С - 20 или 60 сек) - элонгация (72°С - 40 или 60 сек), причем цикл денатурация - отжиг - элонгация повторяется 35 раз, заключительная элонгация 72°С - 5 мин. А при проведении гельэлектрофореза по наличию или отсутствию ампликонов длиной 382 п.н. для BIV и 609 п.н. - для BLV судят о наличии или отсутствии провирусов в лимфоцитах крови КРС.

На фигуре 1 представлена схема строения геномов BIV и BLV.

На фигуре 2 представлена электрофореграмма результатов определения размера продуктов амплификации при применении каждой из пар праймеров в отдельности с использованием маркера молекулярных масс с шагом 100 b.

На фигуре 3 представлена электрофореграмма результатов подбора оптимальной температуры отжига для совместной работы двух пар праймеров в одной системе.

На фигуре 4 представлена электрофореграмма результатов исследования ДНК, полученной из лимфоцитов крови КРС разработанным способом.

На фигуре 5 представлена электрофореграмма результатов исследования тотальной ДНК периферической крови КРС разработанным способом.

Разработка способа диагностики вирусного иммунодефицита и лейкоза КРС осуществлялись в три этапа:

1. Подбор оптимально сочетающихся между собой двух пар праймеров.

2. Моделирование состава реакционной смеси для разрабатываемой диагностической системы.

3. Подбор условий температурно-временного режима проведения мультиплексной ПЦР.

1. Подбор оптимально сочетающихся между собой двух пар праймеров

Выбор пар праймеров осуществляли на основании анализа зарубежных и отечественных литературных источников. Проверку качества и термодинамический анализ праймеров выполняли с помощью программ OLIGO DNA/RNA primer analysis software, v. 5.0. (http.V/molbiol-tools.ca/molecular_biology_freeware.htm#Primer%20design) и BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) с использованием полногеномных сиквенсов BIV и BLV и их фрагментов, размещенных на ресурсе NCBI (http://www.ncbi.nlm.nih.gov/genome/?term=). Геномы BIV и BLV имеют размер ~ 8,4 kb и содержат три основных структурных гена, кодирующих вирусные протеины в следующем порядке: 5'-gag-pol-env-3'. Дополнительно геном BLV содержит регуляторные гены pol, rex и tax, геном BIV - гены BIVgp3 и BIVgp4 (Фиг. 1). При этом основными требованиями были: степень гомологии (комплементарность) с выбранным участком гена; отсутствие самокоплементарных участков внутри праймеров и комплементарности друг другу, чтобы не допускать возникновения устойчивых вторичных структур (димеров); близость значений температуры отжига и плавления праймеров.

На основании проведенного литературного поиска и компьютерного анализа были отобраны две пары праймеров: pBLVf и pBLVr (Panei CJ1, Serena MS, Metz GE, Bravi ME, González ET, Echeverría MG. Analysis of the pX region of bovine leukemia virus in different clinical stages of Enzootic Bovine Leukemia in Argentine Holstein cattle. Virus Res. 2013 Jan; 171 (1): 97-102. doi: 10.1016/j.virusres.2012.08.001. Epub 2012 Nov 16); pBIVf и pBIVr (Колотвин В.В. Вирус иммунодефицита крупного рогатого скота: индикация инфекции и распространенность в хозяйствах Российской Федерации: автореферат диссертации на соискание ученой степени кандидата биологических наук. - Москва, 2007 г.), характеристики которых приведена в таблице 1.

Отобранные две пары олигонуклеотидных праймеров полностью соответствуют требованиям, предъявляемым к праймерам для мультиплексной ПНР: комплементарны выбранному фрагменту ДНК соответствующего провируса; имеют оптимальные размер, структуру и GC-состав; у них отсутствует взаимо- и самокомплементарность; температуры отжига и плавления праймеров близкие; продукты амплификации каждой пары праймеров отличаются по размеру. Как показано на электрофореграмме, ампликоны при применении праймеров pBIVf и pBIVr находятся чуть ниже уровня 400 п.н., при применении праймеров pBLVf и pBLVr - чуть выше уровня 600 п.н., что соответствует расчетным размерам ампликонов: 382 и 609 п.н. соответственно (Фиг. 2).

2. Моделирование состава реакционной смеси для разрабатываемой диагностической системы

Выделение и очистку нуклеиновых кислот из лимфоцитов крови КРС осуществляли методом нуклеосорбции на силикогеле с использованием набора «ДНК-сорб-В» (ООО ИнтерЛабСервис, Россия). ШГР - проводили в объеме реакционной смеси - 25 мкл на 1 пробу. Состав реакционной смеси представлен в таблице 2.

Состав реакционной смеси подбирали таким образом, чтобы концентрация ионов MgCl2 обеспечивала оптимальную скорость и точность работы фермента Taq-полимеразы, а концентрация дНТФ, праймеров и объем пробы способствовали повышению специфичности реакции. При использовании амплификатора с крышкой без нагрева, на смесь наслаивали 20 мкл минерального масла для ПЦР. При использовании амплификатора с нагревающейся крышкой, минеральное масло не использовали.

3. Подбор условий температурно-временного режима проведения мультиплексной ПЦР

Проведение ПЦР с использованием отобранных праймеров осуществляли на амплификаторах «АМПЛИ 4» («Биоком», Россия) и «Т100» («BioRad», США). Температурно-временной режим проведения реакции для амплификаторов представлен в таблице 3.

Для амплификаторов с активным регулированием температуры, по раствору в пробирке, например «Т100», время прохождения всех этапов амплификации (денатурация-отжиг-элонгация) короче, чем для амплификатора с матричным регулированием температуры, например «АМПЛИ 4». При 59°С и 58°С заметны две полосы в треке, причем при 58°С они одинаковые по ширине и интенсивности, а при 59°С полосы имеют разную ширину. Это свидетельствует о различной интенсивности работы праймеров в системе. При 57°С и 56°С заметна лишь полоса на уровне ампликона BLV, а при 55°С трек не содержат ни одной полосы. Оптимальной для работы обоих пар праймеров оказалась температура отжига 58°С (Фиг 3).

Учет осуществляли методом гельэлектрофореза в 1,5% агарозном геле с добавлением бромистого этидия в качестве интерколирующего красителя для ДНК. Результат учитывали на оборудовании фирмы «BioRad» (США). Для определения размера ампликонов, после проведения ПЦР с разработанными праймерами, использовали маркер молекулярных масс «1 kb DNA ladder» («Stratagene», США).

Пример 1. Проверка эффективности разрабатываемой диагностической системы для исследования лимфоцитов крови КРС

Материалом для исследования послужили 28 проб лимфоцитов периферической крови КРС из неблагополучного по лейкозу хозяйства. В качестве положительного контроля использовали ДНК, выделенную из лимфоцитов крови КРС, у которых носительство BLV было подтверждено в реакции иммунодиффузии (Правила по профилактике и борьбе с лейкозом крупного рогатого скота, утвержденные приказом Минсельхозпрода РФ от 11 мая 1999 г. №359), а наличие BIV - методом классической ПЦР (Методические указания по диагностике ВБИ-инфекции крупного рогатого скота методом полимеразной цепной реакции (ПЦР), утверждены академиком-секретарем отделения ветеринарной медицины РАСХН A.M. Смирновым 07.12.2006 г.). Пробы 2, 3, 4, 5, 8, 11, 16 содержат ДНК провирусов BIV и BLV, электрофоретическая подвижность ампликонов которых 382 п.н. и 609 п.н. соответственно, что совпадает с размерами ампликонов в положительном контроле (К+). Пробы 7, 9, 10, 12, 13, 17, 18, 22, 23 содержит только ДНК провируса BIV, пробы 1, 6, 14, 15, 19, 20, 21, 24, 25, 26, 27, 28 - отрицательные. В электрофоретической дорожке, соответствующей отрицательному контролю (К-), полосы отсутствуют (фиг. 4).

Пример 2. Проверка эффективности разрабатываемой диагностической системы для исследования периферической крови КРС

Материалом для исследования послужили 10 проб периферической крови КРС из неблагополучного по лейкозу хозяйства. В качестве положительного контроля использовали ДНК, выделенную из лимфоцитов крови КРС, у которых носительство BLV было подтверждено в реакции иммунодиффузии (Правила по профилактике и борьбе с лейкозом крупного рогатого скота, утвержденные приказом Минсельхозпрода РФ от 11 мая 1999 г. №359), а наличие BIV - методом классической ПЦР (Методические указания по диагностике ВБИ-инфекции крупного рогатого скота методом полимеразной цепной реакции (ПЦР), утверждены академиком-секретарем отделения ветеринарной медицины РАСХН A.M. Смирновым 07.12.2006 г.). Пробы 1, 2, 3, 4, 5, 9 содержат ДНК провирусов BIV и BLV электрофоретическая подвижность ампликонов которых 382 п.н. и 609 п.н. соответственно, что совпадает с размерами ампликонов в положительном контроле (К+). Пробы 6, 7, 10 содержат только ДНК провируса BIV, проба 8 - отрицательная. В электрофоретической дорожке, соответствующей отрицательному контролю (К-), полосы отсутствуют (фиг. 5).

Заявленное изобретение является доступным по стоимости, достоверным, высокочувствительным и высокоспецифичным способом выявления фрагментов провирусной ДНК провирусов иммунодефицита и лейкоза КРС в лимфоцитах крови животных в короткие сроки. При этом компьютерный анализ показал отсутствие реакции на гомологичные и гетерологичные организмы.

Предложенный способ апробирован с положительными результатами и регулярной воспроизводимостью этих результатов в 2015 году на 38 пробах ДНК, полученных из лимфоцитов и периферической крови КРС, принадлежащих частным владельцам и из фермерских хозяйств. Работу проводили на базе межкафедральной учебно-научно-исследовательской лаборатории «Геном» ФГБОУ ВПО «Саратовский ГАУ» и ФКУЗ РосНИПЧИ «Микроб» (г. Саратов).


ДИАГНОСТИЧЕСКАЯ СИСТЕМА ДЛЯ ВЫЯВЛЕНИЯ ДНК ПРОВИРУСОВ ЛЕЙКОЗА И ИММУНОДЕФИЦИТА КРУПНОГО РОГАТОГО СКОТА МЕТОДОМ МУЛЬТИПЛЕКСНОЙ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ
ДИАГНОСТИЧЕСКАЯ СИСТЕМА ДЛЯ ВЫЯВЛЕНИЯ ДНК ПРОВИРУСОВ ЛЕЙКОЗА И ИММУНОДЕФИЦИТА КРУПНОГО РОГАТОГО СКОТА МЕТОДОМ МУЛЬТИПЛЕКСНОЙ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ
ДИАГНОСТИЧЕСКАЯ СИСТЕМА ДЛЯ ВЫЯВЛЕНИЯ ДНК ПРОВИРУСОВ ЛЕЙКОЗА И ИММУНОДЕФИЦИТА КРУПНОГО РОГАТОГО СКОТА МЕТОДОМ МУЛЬТИПЛЕКСНОЙ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ
ДИАГНОСТИЧЕСКАЯ СИСТЕМА ДЛЯ ВЫЯВЛЕНИЯ ДНК ПРОВИРУСОВ ЛЕЙКОЗА И ИММУНОДЕФИЦИТА КРУПНОГО РОГАТОГО СКОТА МЕТОДОМ МУЛЬТИПЛЕКСНОЙ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ
Источник поступления информации: Роспатент

Показаны записи 1-10 из 48.
20.08.2013
№216.012.5ec2

Способ получения чипсов из натурального сыра

Изобретение относится к производству пищевых продуктов длительного хранения, а именно к получению сырных чипсов из натурального сыра. Способ включает нарезку ломтиков натурального сыра толщиной 2,0-2,5 мм, нанесение на них, при необходимости, вкусовых ароматизаторов, последующую обработку...
Тип: Изобретение
Номер охранного документа: 0002489890
Дата охранного документа: 20.08.2013
10.08.2014
№216.012.e835

Смазочная композиция

Настоящее изобретение относится к смазочной композиции, содержащей минеральное масло и порошкообразный наполнитель, полученный при испарении и конденсации пара в плазменном испарителе, при этом масло в качестве порошкообразного наполнителя содержит смесь наноразмерного порошка латуни...
Тип: Изобретение
Номер охранного документа: 0002525238
Дата охранного документа: 10.08.2014
10.08.2014
№216.012.e84b

Колбаса варено-копченая с использованием мяса нутрии

Изобретение относится к мясной промышленности, а именно к производству варено-копченой колбасы. Колбаса варено-копченая получена способом, предусматривающим подготовку говядины жилованной высшего сорта и мяса нутрии, посол говядины, измельчение ее на волчке, измельчение мяса нутрии на кусочки...
Тип: Изобретение
Номер охранного документа: 0002525260
Дата охранного документа: 10.08.2014
10.09.2014
№216.012.f300

Способ очистки фритюрного жира с использованием природных адсорбентов

Изобретение относится к масложировой и пищевой промышленности, именно к методам очистки отработанных фритюрных масел. Способ очистки фритюрного жира с использованием природных адсорбентов, в котором термообработанный фритюрный жир, имеющий температуру 180C, отстаивают от механических примесей,...
Тип: Изобретение
Номер охранного документа: 0002528030
Дата охранного документа: 10.09.2014
27.09.2014
№216.012.f9f4

Многоступенчатый датчик угла

Изобретение относится к измерительной технике и может быть использовано в устройствах автоматики для получения выходных напряжений, пропорциональных углу поворота. В многоступенчатый датчик угла вводятся упоры на роторы и статоры всех ступеней и пружины между роторами и статорами вращающихся...
Тип: Изобретение
Номер охранного документа: 0002529825
Дата охранного документа: 27.09.2014
20.11.2014
№216.013.072b

Способ восстановления изношенного крестового ножа

Изобретение относится к ремонтному производству и может быть использовано при восстановлении крестовых ножей промышленных мясорубок горячей пластической деформацией. В способе осуществляют наплавку на поверхность лезвия ножа, которую ведут последовательно с двух сторон в радиальном...
Тип: Изобретение
Номер охранного документа: 0002533236
Дата охранного документа: 20.11.2014
27.11.2014
№216.013.09c0

Способ производства сосисок деликатесных рыбных

Способ включает подготовку, посол, измельчение рыбного сырья и смешивание его с остальными компонентами, формование в оболочку, термообработку и осадку. В качестве остальных компонентов используют свинину жилованную полужирную, растительное масло, концентрат «Лактобел-ЭД», измельченные листья...
Тип: Изобретение
Номер охранного документа: 0002533904
Дата охранного документа: 27.11.2014
27.11.2014
№216.013.09c1

Колбаса вареная фаршированная "бразильская" из мяса нутрии и способ ее производства

Изобретение относится к мясной промышленности, а именно к производству колбасы вареной фаршированной. Способ предусматривает приготовление фарша из говядины жилованной высшего сорта, мяса нутрии, майорана, специй и пряностей, с добавлением в фарш кусочков соленого шпика свиного бокового,...
Тип: Изобретение
Номер охранного документа: 0002533905
Дата охранного документа: 27.11.2014
27.11.2014
№216.013.0b2d

Колбаса вареная фаршированная "заволжская оригинальная" из мяса нутрии и способ ее производства

Изобретение относится к мясной промышленности, а именно к производству вареных фаршированных колбасных изделий. Способ предусматривает приготовление фарша из говядины жилованной высшего сорта, мяса нутрии, эстрагона сушеного, специй и пряностей, с добавлением соленого шпика бокового и кусочков...
Тип: Изобретение
Номер охранного документа: 0002534269
Дата охранного документа: 27.11.2014
10.12.2014
№216.013.0e42

Биоинтегрируемый композитный материал и способ формирования покрытия на изделиях медицинского назначения с использованием биоинтегрируемого композитного материала

Группа изобретений относится к медицине. Описан биоинтегрируемый композитный материал, включающий следующие компоненты в мас.%: коллаген 5%-10%, полиазолидинаммоний, модифицированный гидрат-ионами галогенов 0,5%-4%, водную дисперсию субмикронных агрегатов флавоноидов 0,5%-1%, воду - остальное....
Тип: Изобретение
Номер охранного документа: 0002535067
Дата охранного документа: 10.12.2014
Показаны записи 1-10 из 73.
20.02.2013
№216.012.26bc

Лопастной питатель

Изобретение относится к области погрузки буртованных сельскохозяйственных грузов, а именно к грузозахватным устройства погрузчиков непрерывного действия (питателям), и может быть использовано в сельскохозяйственных складах, хранилищах и площадках для погрузки грузов, хранящихся в буртах....
Тип: Изобретение
Номер охранного документа: 0002475436
Дата охранного документа: 20.02.2013
10.07.2013
№216.012.5448

Устройство для термофиксации поршневых колец в пакете

Изобретение относится к термофиксации поршневых и уплотнительных колец в пакете во время термической обработки. Устройство состоит из цилиндрической оправки 1 с неподвижным фланцем 2 и цилиндрическим стержнем 3 с резьбой для осуществления осевой стяжки пакета поршневых колец 5 гайкой 4 через...
Тип: Изобретение
Номер охранного документа: 0002487179
Дата охранного документа: 10.07.2013
10.07.2013
№216.012.54f2

Способ определения ресурсных параметров земельного участка при осуществлении поточного землепользования

Изобретение относится к области сельского хозяйства. Способ включает геодезические измерения площади земельного участка, трехмерное измерение земельного участка, основанное на измерении координатной слагающей ресурсных параметров в разных точках данного участка. Ресурсные параметры почвы...
Тип: Изобретение
Номер охранного документа: 0002487349
Дата охранного документа: 10.07.2013
20.07.2013
№216.012.575c

Бон гидротехнический

Изобретение относится к гидротехническому строительству и может быть использовано при сооружении вдольбереговых волноразрушающих конструкций. Бон гидротехнический содержит закрепленные в донном грунте вертикальные опоры, выполненные из труб большого диаметра, и соединенный с ними горизонтальный...
Тип: Изобретение
Номер охранного документа: 0002487972
Дата охранного документа: 20.07.2013
20.07.2013
№216.012.584c

Линейный шаговый электромагнитный двигатель с осевым каналом и протяжным устройством с зацеплением за шайбы

Изобретение относится к электротехнике, к электромагнитным двигателям и может быть использовано для создания машин с дискретным поступательным движением рабочего органа любой длины. Технический результат состоит в упрощении конструкции, расширении эксплуатационных возможностей и областей...
Тип: Изобретение
Номер охранного документа: 0002488212
Дата охранного документа: 20.07.2013
20.08.2013
№216.012.5ec2

Способ получения чипсов из натурального сыра

Изобретение относится к производству пищевых продуктов длительного хранения, а именно к получению сырных чипсов из натурального сыра. Способ включает нарезку ломтиков натурального сыра толщиной 2,0-2,5 мм, нанесение на них, при необходимости, вкусовых ароматизаторов, последующую обработку...
Тип: Изобретение
Номер охранного документа: 0002489890
Дата охранного документа: 20.08.2013
27.08.2013
№216.012.6294

Устройство автоматической очистки клетки для содержания животных

Изобретение относится к сельскому хозяйству. Предложенное устройство автоматической очистки клетки для содержания животных, в которой пол клетки выполнен в виде транспортера 24, под которым установлен скребок 25 для очистки ленты транспортера, содержит два ряда источников 1-6 сигналов на одной...
Тип: Изобретение
Номер охранного документа: 0002490873
Дата охранного документа: 27.08.2013
27.08.2013
№216.012.62ba

Колбаса сырокопченая и способ ее производства

Изобретение относится к мясной промышленности, а именно к производству сырокопченых колбас. Способ предусматривает нарезание говядины и свинины, измельчение на волчке с диаметром отверстий выходной решетки 2-3 мм, приготовление фарша куттерованием в режиме резания до равномерного распределения,...
Тип: Изобретение
Номер охранного документа: 0002490911
Дата охранного документа: 27.08.2013
27.08.2013
№216.012.638f

Шелушильно-сушильная машина

Изобретение относится к устройствам для обработки зерна и может быть использовано в зерноперерабатывающей промышленности, в частности для шелушения пшеницы и ячменя, а также шлифования и полирования при выработке крупы. Шелушильно-сушильная машина содержит корпус 1 с загрузочным 2 и выпускным 3...
Тип: Изобретение
Номер охранного документа: 0002491124
Дата охранного документа: 27.08.2013
20.09.2013
№216.012.6ca0

Уплотнительное устройство поршня

Изобретение относится к уплотнительной технике и может быть использовано для уплотнения поршней и механизмов. Устройство включает два концентрично расположенных в канавке 2 поршня 1, кольца 3 и 6 и расширитель в виде набора спиральных пружин 17. Поршневое кольцо 3 взаимодействует наклонными...
Тип: Изобретение
Номер охранного документа: 0002493459
Дата охранного документа: 20.09.2013

Похожие РИД в системе

+ добавить свой РИД