10.04.2014
216.012.b032

ШТАММ БАКТЕРИЙ BACILLUS PUMILUS МК-10 С НИЗКОЙ ПРОТЕОЛИТИЧЕСКОЙ АКТИВНОСТЬЮ И ЕГО ПРИМЕНЕНИЕ

Вид РИД

Изобретение

Юридическая информация Свернуть Развернуть
Краткое описание РИД Свернуть Развернуть
Аннотация: Изобретение относится к области биотехнологии, а именно к микроорганизмам и ферментам, и представляет собой штамм бактерий Bacillus pumilus МК-10 ВКПМ В-10742. данный штамм получают от исходного штамма бактерий Bacillus pumilus 3-19 путем инактивирования гена мажорной сериновой протеазы на хромосоме. Изобретение позволяет расширить ассортимент штаммов бактерий, используемых в качестве реципиента с низкой протеолитической активностью при производстве гетерологичных белков. 2 з.п.ф-лы, 3 ил., 1 табл., 1 пр.
Реферат Свернуть Развернуть

Заявленное техническое решение (предлагаемый штамм) относится к области биотехнологии, а именно к микроорганизмам и ферментам. Может быть использовано в микробиологической промышленности и генетической инженерии.

Наличие дефекта по генам доминирующих протеаз или дефицит таких генов у бактерий делает их (бактерии) универсальными продуцентами рекомбинантных белков, например,- применяемых для производства лекарственных препаратов со стабильными свойствами.

Известен штамм бактерий Bacillus brevis 31-OK [1] с низкой протеолитической активностью, полученный путем спонтанной мутации после трансформации штамма Bacillus brevis HPD31 плазмидой pNU2OOhGH, несущей ген гормона роста человека. Недостатком [1] является зависимость продуктивности штамма по синтезу экзоферментов от состава питательной среды. Требуется специфическая питательная среда с обязательным добавлением, например, полипептона P1 - в концентрации до 2%, отсутствие которого существенно снижает выход продукции ферментов. Эта зависимость сужает перечень применяемых для культивирования штамма (Bacillus brevis 31-OK) питательных сред, что в свою очередь существенно ограничивает область применения этого штамма в качестве производителя рекомбинантных белков, например, в производстве лекарственных препаратов.

Известен полученный путем многократного УФ (ультрафиолетового) облучения дефектный по протеазам штамм бактерий Bacillus amyloliquefaciens A50-32 [2], обладающий 0,3% протеазной активностью. Недостатком штамма бактерий Bacillus amyloliquefaciens A50-32 [2] является наличие неконтролируемых и непредсказуемых мутаций, например регуляторной мутации. Эти мутации оказывают плейотропный (множественный) эффект на синтез экзоферментов. Из-за этого недостатка (неконтролируемых и непредсказуемых мутаций) продукты жизнедеятельности штамма (экзоферменты), например те, которые используют для производства лекарственных препаратов, нестабильны по свойствам и действию, что существенно ограничивает область применения аналога.

Наиболее близким по существу предлагаемому штамму (прототипом) является протеазо-дефицитный штамм бактерий Bacillus subtilis GX4924 [3] с направленной инактивацией гена субтилизина (сокращенное название гена - apr). Недостатком прототипа [3] является наличие «помехи» в геноме указанного штамма бактерий - гена другой мажорной нейтральной протеазы (сокращенное название гена - npr), доля которой составляет до 54% в общем протеолитическом пуле ферментов (продуктов жизнедеятельности прототипа). Наличие протеазы, выступающей помехой, вызывает дополнительную деградацию рекомбинантных полипептидов, количественно ограничивающих синтез полезных экзоферментов, снижает количество и качество получаемого продукта, например, применяемого в фармацевтике для производства лекарственных препаратов в форме ферментативных добавок, например, для лечения недостаточности экзокринной функции поджелудочной железы.

Заявленное техническое решение поясняется Фиг.1 - 3 и таблицей, на которых представлены:

На Фиг.1 представлена схема поэтапного создания тройной рекомбинирующей конструкции, состоящей из левой (L), правой (R) фланкирующей областей гена aprBp Bacillus pumilus 3-19 и гена резистентности к антибиотику эритромицину erm (E) с использованием плазмиды pGEM-T.

На Фиг.2. представлена схема интеграции тройной рекомбинирующей конструкции, инактивирующей ген aprBp в геном Bacillus pumilus 3-19. Обозначения: aprBp - ген субтилизиноподобной протеазы, erm - ген резистентности к антибиотику эритромицину, волнистой линией обозначены хромосома Bacillus pumilus 3-19 и хромосома Bacillus pumilus MK-10, пунктирной линией обозначен путь интеграции. На Фиг.3. представлены колонии исходного штамма Bacillus pumilus 3-19 (контроль) и нокаутированного/протеазо-негативного штамма Bacillus pumilus MK-10 (опыт) на 2% молочном агаре.

Целью предлагаемого изобретения является получение штамма-реципиента бактерий вида Bacillus pumilus с низкой протеолитической активностью для производства чистых гомологичных и рекомбинантных белков, повышение чистоты используемых в полезных целях продуктов жизнедеятельности бактерий.

Цели достигают тем, что в качестве реципиента с низкой протеолитической активностью применяют штамм бактерий Bacillus pumilus MK-10 ВКПМ В-10742, получаемый от исходного штамма бактерий Bacillus pumilus 3-19 путем инактивирования гена мажорной сериновой протеазы на хромосоме. Штамм бактерий Bacillus pumilus MK-10 ВКПМ В-10742 используют в качестве реципиента с низкой протеолитической активностью. Штамм бактерий применяют для производства гомологичных белков Bacillus pumilus. Штамм бактерий применяют для производства гетерологичных белков рода Bacillus.

Предлагаемый штамм Bacillus pumilus MK-10 получают, например, описанным далее путем. С применением известных компьютерных программ, например программного обеспечения Oligo Calc [4], известным путем [5] конструируют олигонуклеотидные праймеры с использованием общедоступной базы данных NCBI (National Center for Biotechnology Information - Национальный центр биотехнологической информации) [6]. Последовательности гена субтилизиноподобной протеазы (aprBp) и гена резистентности к антибиотику эритромицину (erm) используют, например, из общедоступной базы данных NCBI. Последовательности праймеров приведены в таблице.

Таблица
Праймеры, используемые для получения штамма Bacillus pumilus MK-10
Название праймера Последовательность праймера
Sub left up 5' GAAGTCAAACAAACGGTGTCC 3'
Sub left low 5' GAATACCAACATGACGAATCCCCCACGTTGTAATCAAGGACC 3'
Sub right up 5' GGGCACTCTAATAACTACCAAAATTGGTGTTCTTGGGGTCG 3'
Sub right low 5' AGAGAGGGATCCGAGAGGCAGGGGTGACGTCTTTTC 3'
Em up 5' GGGATTCGTCATGTTGGTATTC 3'
Em low 5' ATTGGTAGTTATTAGAGTGCCC 3'
SP6 5' GATTTAGGTGACACTATAG 3'
T7 5' TAATACGACTCACTATAGGG 3'

Дальнейшие действия показаны на Фиг.1. Методом полимеразно-цепной реакции (далее по тексту - ПЦР) проводят амплификацию левого (L) и правого (R) фланкирующих участков гена aprBp с геномной ДНК штамма бактерий Bacillus pumilus 3-19 при использовании олигонулеотидных пар Sub left up/Sub left low и Sub right up/Sub right low соответственно. ПЦР для получения гена erm проводят с плазмиды pCS9 с использованием праймеров Em up/Em low. В результате нарабатывают амплификаты одинарных конструкций (с длиной, например, ~1 kb или одной килобазы).

Затем амплификаты одинарных конструкций используют как сырье и путем ПЦР получают двойные конструкции: левый фланкирующий регион aprBp+erm (LE) и правый фланкирующий регион aprBp+erm (ER). При этом в ПЦР используют олигонуклеотидные пары Sub left up/Em low (LE) и Em up/Sub right low (ER) соответственно. Продукты амплификации (двойные конструкции), электрофоретически соответствующие ожидаемой длине (продуктов амплификации) в ~2 kb, выделяют из агарозного геля, например - с использованием набора реактивов фирмы Fermentas (Литва).

Полученные двойные конструкции (LE и ER) клонируют в плазмиду pGEM-T Easy (Promega, США) путем лигирования по липким Т-концам плазмиды и А-концам амплификатов. Лигазной смесью трансформируют известный штамм бактерий Escherichia coli XL-1 Blue. Трансформацию проводят, например, по известной методике [7]. Суспензию трансформированных клеток высевают на чашки с агаризованной средой, содержащей 5-бромо-4-хлоро-3-индоил-бета-D-галактопиранозид, например, в концентрации 40 mg/ml, изопропил-β-D-1-тиогалактопиранозид, например, в концентрации 32 mg/ml и ампициллин, например, в концентрации 20 mg/ml. Используют, например, реактивы фирмы Fermentas (Литва). После инкубации трансформантов в течение 24 часов при плюс 37°С на чашках образуются белые (содержащие LE и ER клонированные конструкции) и синие (не содержащие конструкций) колонии бактериальных клеток.

Отбирают белые колонии бактерий, с которых проводят ПЦР-скрининг с фланкирующих праймеров (Т7, SP6) на наличие вставки в плазмиде pGEM-T Easy длиной (продукта амплификации) в ~2 kb. Из положительных (содержащих продукт амплификации) колоний бактерий путем щелочного лизиса выделяют плазмиды pGEMTE-LE и pGEMTE-ER со вставками LE и ER соответственно.

Проводят реакцию амплификации и получают тройную рекомбинирующую конструкцию (LER). Для этого используют плазмиды pGEMTE-LE и pGEMTE-ER в качестве матрицы и праймеры Sub left up/Sub right low. Продукт реакции амплификации, соответствующий электрофоретически ожидаемой длине в ~3 kb, очищают из агарозного геля, например, с использованием набора фирмы Fermentas (Литва).

Заключительным этапом по получению предлагаемого протеазо-дефицитного штамма бактерий Bacillus pumilus является трансформация клеток бактерий Bacillus pumilus 3-19 полученной тройной рекомбинирующей конструкцией. Трансформацию проводят по методу [8], при этом используют синтетические минимальные среды Спецайзена 1/11. Солевая основа среды Спецайзена (%): К2НРО4×3Н2О - 18,34; KH2PO4 (безводный) - 6,0; (NH4)2SO4 - 2,0; цитрат - Na - 1.2. Отдельно готовят растворы: глюкоза - 40%; казаминовые кислоты - 200 mg/ml; Mg2SO4 - 0,2 g/ml. Среда Спецайзена I: на 100 ml H2O: глюкоза - 2 ml; казаминовые кислоты - 2 ml; дрожжевой экстракт - 2 ml; Mg2SO4 - 0,1 ml; солевая основа - 10 ml. Среда Спецайзена II: на 100 ml H2O: глюкоза - 2 ml; казаминовые кислоты - 1 ml; Mg2SO4 - 8 µ1; солевая основа - 10 ml).

Суспензию содержащих тройную рекомбинирующую конструкцию компетентных клеток Bacillus pumilus 3-19 рассевают на чашки с агаризованной средой с антибиотиком эритромицином, например, в концентрации 20 Hg/ml. После инкубации в течение от 24 до 48 часов при +37°С отбирают, например, три независимых клона, растущих на среде с эритромицином. Дополнительную проверку наличия (или отсутствия) гена протеазы выполняют с применением ПЦР. Выявленное в результате ПЦР наличие вставки гена erm (внутри гена протеазы aprBp) подтверждает разрушение функционального гена, т.е. достижение цели изобретения - получение имеющих генотип aprBp::.erm модифицированного штамма бактерий, именуемых как Bacillus pumilus MK-10.

Описание предлагаемого штамма

Штамм бактерий Bacillus pumilus MK-10 депонирован во Всероссийской коллекции промышленных микроорганизмов ФГУП ГосНИИГенетика под регистрационным номером ВКПМ В-10742. Предлагаемый штамм является производным от штамма Bacillus pumilus 3-19 и содержит гены минорных протеаз, например глутамилэндопептидазы, адамализиноподобной металлопротеазы.

Генетические особенности штамма

Предлагаемый штамм бактерий Bacillus pumilus MK-10 несет ген резистентности к антибиотику эритромицину, фланкированный участками гена субтилизиноподобной протеазы Bacillus pumilus 3-19. Ген aprBp инактивирован посредством гомологичной рекомбинации (Фиг.2).

Культурально-морфологические особенности штамма

Предлагаемый штамм бактерий Bacillus pumilus МК10 - аэробные, грамположительные бактерии. Клетки палочковидные, прямые или изогнутые, располагаются скоплениями или обособленно. Размер выращенных на агаризованной среде клеток односуточной культуры составляет 14-15 мкм. Свободные споры появляются на сороковые часы роста (не более 5%), далее их количество нарастает и достигает максимального значения (до 80%) в поздней стационарной фазе роста. При росте на агаризованной среде Лурия-Бертани (далее по тексту - LB) колонии имеют более шероховатую поверхность и неровные края по сравнению с более гладкими и ровными колониями исходного штамма Bacillus pumilus 3-19.

Физиолого-биохимические свойства

Среда для выращивания, например LB: триптон - 10 g/l, дрожжевой экстракт - 5 g/l, NaCl - 10 g/l, pH 8.5 с антибиотиком эритромицином, например, в конечной концентрации 20 µg/ml. Для создания твердой питательной среды дополнительно вносят 2% агар. Оптимальная температура роста +37°С.

Протеолитическая активность предлагаемого штамма

Активность штамма определяют, например, следующим способом.

Определение протеолитической активности протеазо-дефицитного штамма Bacillus pumilus MK-10 проводят на среде, содержащей 2% молочного агара. Наличие протеолитической активности при этом определяют по появлению области просветления на молочном агаре (зоны расщепления белков молока). В результате селекции (отбора), например, трех колоний, которые не имеют зон просветления на молочной среде, получают предлагаемый штамм.

Выраженные зоны протеолиза на молочном агаре (2% агара и 1% молоко) наблюдают только у исходного штамма бактерий Bacillus pumilus 3-19. У предлагаемого штамма Bacillus pumilus MK-10 просветление менее выражено по сравнению с исходным штаммом Bacillus pumilus 3-19 (Фиг.3), что указывает на инактивацию гена секретируемой субтилизиноподобной протеазы. Наличие остаточных зон лизиса объясняется присутствием активности других секретируемых протеаз, например металлопротеазы. Таким образом, предлагаемый штамм бактерий Bacillus pumilus MK-10 обладает низкой протеолитической активностью.

Пример применения предлагаемого штамма бактерий Bacillus pumilus MK-10 приведен далее.

ПРИМЕР. Использование предлагаемого штамма для производства и синтеза рекомбинантных гомо- и гетерологичных белков р.Bacillus, применяемых для создания лекарственных препаратов.

Отличительным свойством исходного штамма Bacillus pumilus 3-19, из которого получен предлагаемый штамм, является наличие в хромосоме гена одной мажорной сериновой субтилизиноподобной протеазы. То есть у предлагаемого штамма, в отличие от прототипа, отсутствует вторая мажорная секретируемая протеаза, наличие которой приводило бы к деградации рекомбинантных белков и снижало эффективность (уровень синтеза и качество целевого белка) получаемой продукции. Инактивация гена единственного мажорного фермента (субтилизиноподобной протеазы) позволяет получить штамм Bacillus pumilus MK-10 с низкой, по сравнению с прототипом, протеолитической активностью. В результате общая протеолитическая активность штамма снижена в 2,5 раза по сравнению с активностью исходного штамма. Таким образом, предлагаемый штамм Bacillus pumilus MK-10 обеспечивает его использование в качестве реципиента для экспрессии гомологичных генов из бактерий рода Bacillus pumilus. Данное свойство связано с отсутствием вариаций последовательностей Shine Dalgarno (Шайна Дальгарно) в промоторах генов, выделенных из штаммов Bacillus pumilus. Поэтому предлагаемый штамм является наиболее эффективным при производстве промышленно важных ферментов, например, субтилизиноподобной протеазы Bacillus pumilus, имеющей потенциал в создании тромболитических лекарственных препаратов [9]. То есть предлагаемый штамм позволяет избавиться от присущих прототипу возможных изменений эффективности трансляции белков и тем самым добиться стабильности свойств продуктов, получаемых как результат жизнедеятельности этих микроорганизмов и реализуемых в биотехнологиях производства препаратов, например, применяемых в медицине, ветеринарии, сельскохозяйственном производстве и производстве продуктов питания.

Предлагаемый штамм в качестве хозяина применяют, например, нижеописанным методом для экспрессии гомологичных генов Bacillus pumilus.

1. Клетки бактерий предлагаемого штамма Bacillus pumilus МК-10 трансформируют плазмидой, содержащей ген рекомбинантного белка (например, гена субтилизиноподобной протеазы aprBp штамма Bacillus pumilus 3-19) под контролем индуцибельного или конститутивного промотора. Полученные трансформированные клетки подращивают на питательной среде, например LB, при температуре инкубации +37°С. Индукцию синтеза белка осуществляют в соответствии с выбранным промотором.

2. Пробы для анализа белков отбирают из КЖ путем отделения супернатанта от клеточной массы, например, через 1 ч и 16 ч после индукции.

3. Внеклеточные белки в пробе (культуральной жидкости или КЖ) характеризуют с помощью электрофореза в полиакриламидном геле по Лэммли [10].

4. Рекомбинантные белки далее очищают различными методами, например с помощью аффинной хроматографии, гель-фильтрации, ионно-обменной хроматографии, высаливания.

Таким образом, пример показывает, что предлагаемый штамм бактерий Bacillus pumilus МК-10 за счет снижения деградации белкового продукта позволяет получать рекомбинантные белки, например, для применения в медицине, ветеринарии, в сельском хозяйстве для растениеводства.

Кроме того, предлагаемый штамм применяют для экспрессии гетерологичных генов р.Bacillus по приведенному выше методу.

Пример применения предлагаемого штамма бактерий показывает его полезность в биотехнологии при промышленном производстве рекомбинантных белков. Использование предлагаемого штамма также способствует выявлению регуляторных свойств инактивированного фермента AprBp, что вносит свой вклад в фундаментальную молекулярную биологию. Предлагаемый штамм имеет изобретательский уровень, поскольку в опубликованной литературе не выявлены протеазо-дефицитные штаммы вида Bacillus pumilus.

ИСПОЛЬЗОВАННЫЕ ИСТОЧНИКИ

1. Kajino Т., Kato К., Miyazaki С., Asami О., Hirai M., Yamada Y., Udaka S. Isolation of a protease-deficient mutant of Bacillus brevis and efficient secretion of a fungal protein disulfide isomerase by the mutant / J Biosci Bioeng. 1999. 87(1): 37-42.

2. Plotnikova Т.О., Selivanova G.N., Iomantas Iu.V., Kozlov IuI. Isolation and analysis of protease-deficient mutants of Bacillus amyloliquefaciens I Genetika. - 1992. 28(5):66-72.

3. Fahnestock S.R., Fisher K.E. Protease-deficient Bacillus subtilis host strains for production of Staphylococcal protein A / Appl. Environ. Microbiol. 1987. 53(2):379-84.

4. http://www.basic.northwestern.edu/biotools/oligocalc.html

5. Маниатис Т., Фрич Э., Сэмбрук Дж. Методы генетической инженерии. Молекулярное клонирование // - M.: «Мир», 1984.

6. http://www.ncbi.nlm.nih.gov/

7. Sambrook J. Molecular cloning: a laboratory manual / J.Sambrook, E.F.Fritsch, T.Maniatis. - 2nd ed. NY: Cold Spring Harbor Laboratory Press, 1989.

8. Harwood, С.R., S.M.Cutting. 1990. Molecular biological methods for Bacillus. John Wiley & Sons, Chichester, England.

9. Ицкович Е.Л., Лютова Л.И., Балабан Н.П., Марданова A.M., Шакиров Е.В., Шарипова М.Р., Лещинская И.Б., Руденская Г.Н. Тромболитические и антикоагулянтные свойства тиолзависимой сериновой протеиназы Bacillus intermedms 3-19 / Вопросы медицинской химии, 1999, №5.

10. Laemmli, U.К. Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4 [Text] / U.K.Laemmli //Nature. - 1970. - V.227. - P.680-685.


ШТАММ БАКТЕРИЙ BACILLUS PUMILUS МК-10 С НИЗКОЙ ПРОТЕОЛИТИЧЕСКОЙ АКТИВНОСТЬЮ И ЕГО ПРИМЕНЕНИЕ
ШТАММ БАКТЕРИЙ BACILLUS PUMILUS МК-10 С НИЗКОЙ ПРОТЕОЛИТИЧЕСКОЙ АКТИВНОСТЬЮ И ЕГО ПРИМЕНЕНИЕ
ШТАММ БАКТЕРИЙ BACILLUS PUMILUS МК-10 С НИЗКОЙ ПРОТЕОЛИТИЧЕСКОЙ АКТИВНОСТЬЮ И ЕГО ПРИМЕНЕНИЕ
Источник поступления информации: Роспатент

Показаны записи 1-10 из 60.
10.04.2013
№216.012.3370

Способ повышения эффективности вирусной трансдукции

Изобретение относится к области биотехнологии. Эукариотические клетки трансдуцируют ретровирусом в присутствии гистонного белка бис-мет-гистона И 1.3. Способ позволяет повысить эффективность ретровирусной трансдукции и избежать недостатков аналогов. Изобретение может быть использовано в...
Тип: Изобретение
Номер охранного документа: 0002478711
Дата охранного документа: 10.04.2013
27.04.2013
№216.012.3a3e

Антибактериальные соединения на основе сульфаниловой кислоты и пиридоксина

Изобретение относится к синтетическим биологически активным веществам гетероциклического ряда и представляет собой продукты модификации сульфаниловой кислоты, а именно n-(1,5-дигидро-3-метил-8-R-8-R-9-гидрокси-[1,3]диоксепино[5,6-с]пиридинил-6-азо)фенилсульфокислоты и их солевые формы общей...
Тип: Изобретение
Номер охранного документа: 0002480471
Дата охранного документа: 27.04.2013
20.05.2013
№216.012.407a

Способ биоремедиации воды, загрязненной тринитротолуолом

Изобретение относится к области биотехнологии. Предложен способ биоремедиации воды, загрязненненной 2,4,6-тринитротолуолом (ТНТ). Способ осуществляют в трех последовательно соединенных биореакторах с непрерывным протоком очищаемой среды. На первом этапе биореакторы наполняют на одну треть...
Тип: Изобретение
Номер охранного документа: 0002482076
Дата охранного документа: 20.05.2013
27.05.2013
№216.012.4572

Способ идентификации пользователя мобильного устройства по его уникальной подписи

Изобретение относится к области вычислительной техники, а именно к способам защиты информации от несанкционированного проникновения, и может быть использовано для защиты как мобильных, так и стационарных устройств с сенсорными дисплеями посредством идентификации пользователя, основанной на...
Тип: Изобретение
Номер охранного документа: 0002483355
Дата охранного документа: 27.05.2013
20.07.2013
№216.012.580b

Способ отвода паров криогенных жидкостей из криогенной системы погружного каротажного оборудования

Изобретение относится к области изготовления, градуировки и обслуживания приборов и устройств для геофизических измерений и может быть использовано в оборудовании для каротажа, содержащем систему охлаждения с использованием криогенных жидкостей. Заявлен способ отвода на поверхность паров...
Тип: Изобретение
Номер охранного документа: 0002488147
Дата охранного документа: 20.07.2013
20.08.2013
№216.012.5f09

Способ выявления способности восприятия глубины и объема плоскостного изображения

Изобретение относится к оптике, нейронауке, медицине, физиологии, экологии человека и может быть использовано в экспериментальной психологии, системе образования всех уровней обучения, при контроле качества образования, в области подготовки экспертов по контролю качества образования, в области...
Тип: Изобретение
Номер охранного документа: 0002489961
Дата охранного документа: 20.08.2013
10.09.2013
№216.012.68c9

Способ определения биологической активности вещества

Настоящее изобретение относится к медицине и описывает способ определения биологической активности вещества, заключающийся в том, что выделяют клетки из биологических тканей человека или животных, проводят мечение с использованием флюоресцентного красителя, ко-культивируют с пораженными...
Тип: Изобретение
Номер охранного документа: 0002492472
Дата охранного документа: 10.09.2013
20.09.2013
№216.012.6b8d

Древесно-наполненная пластмасса и способ ее получения

Изобретение относится к технологии получения древесно-полимерных композиций и может быть использовано в промышленности строительных материалов, мебельной промышленности, машиностроении и других отраслях промышленности. Древесно-полимерная композиция состоит из, мас.%: древесно-растительного...
Тип: Изобретение
Номер охранного документа: 0002493184
Дата охранного документа: 20.09.2013
27.09.2013
№216.012.6dda

Способ развития способности зрительного анализатора к восприятию глубины и объема плоскостного изображения

Изобретение относится к области медицины, а именно к психологии, психофизиологии, физиологии, оптике, экологии человека, и может быть использовано в системе образования на всех ее уровнях, при изучении деятельности мозга; нейронауке, при построении новых принципов деятельности нейронных сетей;...
Тип: Изобретение
Номер охранного документа: 0002493773
Дата охранного документа: 27.09.2013
10.10.2013
№216.012.7454

Датчик угловой скорости и угловых перемещений и способ его работы

Изобретение относится к измерительным приборам, выполняющим измерения с помощью оптических и электрических средств, и может быть использовано для контроля угловой скорости вращения, угловых перемещений и поворота механизмов. Датчик содержит автономный источник электропитания, преобразователь...
Тип: Изобретение
Номер охранного документа: 0002495437
Дата охранного документа: 10.10.2013
Показаны записи 1-10 из 76.
10.04.2013
№216.012.3370

Способ повышения эффективности вирусной трансдукции

Изобретение относится к области биотехнологии. Эукариотические клетки трансдуцируют ретровирусом в присутствии гистонного белка бис-мет-гистона И 1.3. Способ позволяет повысить эффективность ретровирусной трансдукции и избежать недостатков аналогов. Изобретение может быть использовано в...
Тип: Изобретение
Номер охранного документа: 0002478711
Дата охранного документа: 10.04.2013
27.04.2013
№216.012.3a3e

Антибактериальные соединения на основе сульфаниловой кислоты и пиридоксина

Изобретение относится к синтетическим биологически активным веществам гетероциклического ряда и представляет собой продукты модификации сульфаниловой кислоты, а именно n-(1,5-дигидро-3-метил-8-R-8-R-9-гидрокси-[1,3]диоксепино[5,6-с]пиридинил-6-азо)фенилсульфокислоты и их солевые формы общей...
Тип: Изобретение
Номер охранного документа: 0002480471
Дата охранного документа: 27.04.2013
20.05.2013
№216.012.407a

Способ биоремедиации воды, загрязненной тринитротолуолом

Изобретение относится к области биотехнологии. Предложен способ биоремедиации воды, загрязненненной 2,4,6-тринитротолуолом (ТНТ). Способ осуществляют в трех последовательно соединенных биореакторах с непрерывным протоком очищаемой среды. На первом этапе биореакторы наполняют на одну треть...
Тип: Изобретение
Номер охранного документа: 0002482076
Дата охранного документа: 20.05.2013
27.05.2013
№216.012.4572

Способ идентификации пользователя мобильного устройства по его уникальной подписи

Изобретение относится к области вычислительной техники, а именно к способам защиты информации от несанкционированного проникновения, и может быть использовано для защиты как мобильных, так и стационарных устройств с сенсорными дисплеями посредством идентификации пользователя, основанной на...
Тип: Изобретение
Номер охранного документа: 0002483355
Дата охранного документа: 27.05.2013
20.07.2013
№216.012.580b

Способ отвода паров криогенных жидкостей из криогенной системы погружного каротажного оборудования

Изобретение относится к области изготовления, градуировки и обслуживания приборов и устройств для геофизических измерений и может быть использовано в оборудовании для каротажа, содержащем систему охлаждения с использованием криогенных жидкостей. Заявлен способ отвода на поверхность паров...
Тип: Изобретение
Номер охранного документа: 0002488147
Дата охранного документа: 20.07.2013
20.08.2013
№216.012.5f09

Способ выявления способности восприятия глубины и объема плоскостного изображения

Изобретение относится к оптике, нейронауке, медицине, физиологии, экологии человека и может быть использовано в экспериментальной психологии, системе образования всех уровней обучения, при контроле качества образования, в области подготовки экспертов по контролю качества образования, в области...
Тип: Изобретение
Номер охранного документа: 0002489961
Дата охранного документа: 20.08.2013
10.09.2013
№216.012.68c9

Способ определения биологической активности вещества

Настоящее изобретение относится к медицине и описывает способ определения биологической активности вещества, заключающийся в том, что выделяют клетки из биологических тканей человека или животных, проводят мечение с использованием флюоресцентного красителя, ко-культивируют с пораженными...
Тип: Изобретение
Номер охранного документа: 0002492472
Дата охранного документа: 10.09.2013
20.09.2013
№216.012.6b8d

Древесно-наполненная пластмасса и способ ее получения

Изобретение относится к технологии получения древесно-полимерных композиций и может быть использовано в промышленности строительных материалов, мебельной промышленности, машиностроении и других отраслях промышленности. Древесно-полимерная композиция состоит из, мас.%: древесно-растительного...
Тип: Изобретение
Номер охранного документа: 0002493184
Дата охранного документа: 20.09.2013
27.09.2013
№216.012.6dda

Способ развития способности зрительного анализатора к восприятию глубины и объема плоскостного изображения

Изобретение относится к области медицины, а именно к психологии, психофизиологии, физиологии, оптике, экологии человека, и может быть использовано в системе образования на всех ее уровнях, при изучении деятельности мозга; нейронауке, при построении новых принципов деятельности нейронных сетей;...
Тип: Изобретение
Номер охранного документа: 0002493773
Дата охранного документа: 27.09.2013
10.10.2013
№216.012.7454

Датчик угловой скорости и угловых перемещений и способ его работы

Изобретение относится к измерительным приборам, выполняющим измерения с помощью оптических и электрических средств, и может быть использовано для контроля угловой скорости вращения, угловых перемещений и поворота механизмов. Датчик содержит автономный источник электропитания, преобразователь...
Тип: Изобретение
Номер охранного документа: 0002495437
Дата охранного документа: 10.10.2013

Похожие РИД в системе